Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Alligator mississippiensis (American alligator) Ami-Mir-29-P1b-v1_3p (mature (guide)) URS000024463E_8496

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Alligator mississippiensis. Annotated by 1 database (MirGeneDB).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGCACCAUUUGAAAUCAGUGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 45 other species

    1. Anolis carolinensis (green anole) Aca-Mir-29-P1d-v1_3p (mature (guide))
    2. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-29b
    3. Bos taurus (cattle) bta-miR-29b
    4. Callithrix jacchus cja-miR-29b
    5. Callorhinchus milii Cmi-Mir-29-P1b_3p (mature (guide))
    6. Canis lupus familiaris cfa-miR-29b
    7. Cavia porcellus (domestic guinea pig) cpo-miR-29b-3p
    8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-29-P1b-v1_3p (mature (guide))
    9. Columba livia cli-miR-29b-3p
    10. Cricetulus griseus cgr-miR-29b-3p
    11. Cyprinus carpio (common carp) ccr-miR-29b
    12. Danio rerio (zebrafish) dre-miR-29b3-3p
    13. Dasypus novemcinctus dno-miR-29b-3p
    14. Echinops telfairi Ete-Mir-29-P1b-v1_3p (mature (guide))
    15. Equus caballus eca-miR-29b
    16. Gallus gallus (chicken) gga-miR-29b-3p
    17. Gekko japonicus Gja-Mir-29-P1b-v1_3p (mature (guide))
    18. Homo sapiens (human) hsa-miR-29b-3p
    19. Latimeria chalumnae Lch-Mir-29-P1b_3p (mature (guide))
    20. Lepisosteus oculatus (spotted gar) Loc-Mir-29-P1b-v1_3p (mature (guide))
    21. Macaca mulatta (Rhesus monkey) mml-miR-29b-3p
    22. Maylandia zebra (zebra mbuna) mze-miR-29b
    23. Microcaecilia unicolor Mun-Mir-29-P1d-v1_3p (mature (guide))
    24. Microcebus murinus mmr-miR-29b
    25. Monodelphis domestica Mdo-Mir-29-P1b-v1_3p (mature (guide))
    26. Monopterus albus (swamp eel) Mal-Mir-29-P1d2-v1_3p (mature (guide))
    27. Mus musculus mmu-miR-29b-3p
    28. Neolamprologus brichardi nbr-miR-29b
    29. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-29b
    30. Ophiophagus hannah oha-miR-29b-3p
    31. Ornithorhynchus anatinus (platypus) Oan-Mir-29-P1b-v1_3p (mature (guide))
    32. Oryctolagus cuniculus ocu-miR-29b-3p
    33. Otolemur garnettii oga-miR-29b
    34. Pteropus alecto (black flying fox) pal-miR-29b-3p
    35. Python bivittatus Pbv-Mir-29-P1d-v1_3p (mature (guide))
    36. Rattus norvegicus rno-miR-29b-3p
    37. Saccoglossus kowalevskii Sko-Mir-29-P1_3p (mature (guide))
    38. Sarcophilus harrisii Sha-Mir-29-P1b-v1_3p (mature (guide))
    39. Scyliorhinus torazame (cloudy catshark) Sto-Mir-29-P1d_3p (mature (guide))
    40. Sphenodon punctatus Spt-Mir-29-P1b_3p (mature (guide))
    41. Sus scrofa ssc-miR-29b
    42. Taeniopygia guttata Tgu-Mir-29-P1b-v1_3p (mature (guide))
    43. Tupaia chinensis tch-miR-29b-3p
    44. Xenopus laevis (African clawed frog) xla-miR-29b-3p
    45. Xenopus tropicalis (tropical clawed frog) xtr-miR-29b