Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3174 URS0000243FF1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3174: Hsa-mir-3174 is a microRNA that has been found to be higher in MMVP specimens compared to FED samples [PMC4881574]. It is part of a network of microRNAs that interact with various messenger RNAs (mRNAs) and long non-coding RNAs (lncRNAs) [PMC9738797]. Additionally, hsa-mir-3174 has been shown to be one of the miRNAs that interact with differentially expressed circular RNAs (circRNAs) and mRNAs [PMC9428625]. In a study, hsa-mir-3174 was identified as one of the statistically significant differentially expressed miRNAs in relation to certain long non-coding RNAs and survival curves [PMC8683174]. Furthermore, hsa-mir-3174 belongs to the mir-3174 family, which includes miRNA families common to human, rhesus, and mouse genomes [PMC3059204]. References: [PMC4881574]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4881574/ [PMC9738797]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9738797/ [PMC9428625]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9428625/ [PMC8683174]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8683174/ [PMC3059204]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3059204/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGUGAGUUAGAGAUGCAGAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications