Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-423 precursor secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-423 precursor URS0000238C62_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-423: Bta-mir-423 is a microRNA that has been identified as a potential biomarker and therapeutic target for bovine endometritis [PMC8433134]. It has been found to target FOXJ1 and bta-miR-149 in specific modules [PMC8433134]. In addition, several sub-networks in brown and turquoise modules have been identified, including mRNAs such as IRAK1, AKT1, STAT3, CCDC39, and ZMYND10, as well as lncRNAs and other miRNAs [PMC8433134]. Bta-mir-423 has also been found to be more abundant than its corresponding miRNA in certain cases [PMC2713767]. It is a unique miRNA found in pregnant ewes on day 14 [PMC8831238]. Bta-mir-423 is thought to target genes associated with metabolism, immune system, cell cycle, and apoptosis [PMC5699189]. Overall, bta-mir-423 shows potential for its role in bovine endometritis and may serve as a valuable biomarker for this infection.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAAAGGAAGUUAGGCUGAGGGGCAGAGAGCGAGACUUUUCUAUUUUCCAAAAGCUCGGUCUGAGGCCCCUCAGUCUUGCUUCCUACCCCGCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Ailuropoda melanoleuca (giant panda) mir-423
  2. Macaca mulatta microRNA mml-mir-423 precursor
  3. Pan troglodytes (chimpanzee) miRNA
2D structure Publications