v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Macaca mulatta (Rhesus monkey) microRNA mml-mir-423 precursor secondary structure diagram

Macaca mulatta (Rhesus monkey) microRNA mml-mir-423 precursor URS0000238C62_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUAAAGGAAGUUAGGCUGAGGGGCAGAGAGCGAGACUUUUCUAUUUUCCAAAAGCUCGGUCUGAGGCCCCUCAGUCUUGCUUCCUACCCCGCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Ailuropoda melanoleuca (giant panda) mir-423
  2. Bos taurus (cattle) microRNA bta-mir-423 precursor
  3. Pan troglodytes (chimpanzee) miRNA
 2D structure Publications