Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-let-7i-3p URS0000237CBD_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (RefSeq, miRBase, TarBase, MalaCards, ENA, GeneCards, LncBase). Homo sapiens (human) hsa-let-7i-3p sequence is a product of let-7i, MIRLET7I, hsa-let-7i-3p, let-7, hsa-let-7i, let-7i-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 53BP1, AAMP, ABP620, AC093525.2, ACF7, ANKRD52, AP3S2, ARRDC6, ARSACS, ASS.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CUGCGCAAGCUACUGCCUUGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 92 other species

    1. Alligator mississippiensis ami-let-7i-3p
    2. Artibeus jamaicensis aja-let-7i
    3. Capra hircus chi-let-7i-3p
    4. Cavia porcellus (domestic guinea pig) cpo-let-7i-3p
    5. Cervus elaphus (red deer) cel-let-7i-p3
    6. Chrysemys picta (Painted turtle) cpi-let-7i-3p
    7. Columba livia (rock pigeon) cli-let-7i-3p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-let-7i-3p
    9. Mus musculus mmu-let-7i-3p
    10. Oryctolagus cuniculus (rabbit) ocu-let-7i-3p
    11. Python bivittatus pbv-let-7i-3p
    12. Rattus norvegicus rno-let-7i-3p
    13. Sus scrofa (pig) ssc-let-7i-3p
    14. Taeniopygia guttata (zebra finch) tgu-let-7i-3p
    Publications New