Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-335-5p URS0000237AF9_9606

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAAGAGCAAUAACGAAAAAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bos taurus (cattle) bta-miR-335
  2. Canis lupus familiaris (dog) cfa-miR-335
  3. Capra hircus miR-335
  4. Cervus elaphus cel-miR-335
  5. Eptesicus fuscus efu-miR-335
  6. Equus caballus eca-miR-335
  7. Macaca mulatta mml-miR-335-5p
  8. Mus musculus (house mouse) mmu-miR-335-5p
  9. Ovis aries (sheep) miscellaneous RNA
  10. Pan troglodytes (chimpanzee) ptr-miR-335
  11. Pongo pygmaeus (Bornean orangutan) ppy-miR-335
  12. Rattus norvegicus rno-miR-335
Publications