Mus musculus (house mouse) mmu-miR-181d-5p URS0000236310_10090

• 23 nucleotides
• 6 databases (ENA, LncBase, miRBase, PirBase, RefSeq, TarBase)
• Found in 14 other species
• 671 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AACAUUCAUUGUUGUCGGUGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

1. Bos taurus bta-miR-181d
2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-181d
3. Canis lupus familiaris cfa-miR-181d
4. Capra hircus chi-miR-181d
5. Cricetulus griseus cgr-miR-181d-5p
6. Gorilla gorilla gorilla ggo-miR-181d (MIR181D)
7. Gorilla gorilla ggo-miR-181d
8. Homo sapiens hsa-miR-181d-5p
9. Macaca mulatta mml-miR-181d
10. Otolemur garnettii oga-miR-181d
11. Pan troglodytes (chimpanzee) ptr-miR-181d
12. Pongo pygmaeus ppy-miR-181d
13. Rattus norvegicus (Norway rat) rno-miR-181d-5p
14. Tupaia chinensis tch-miR-181d

Publications Download

• FASTA
• JSON