Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ophiophagus hannah (king cobra) oha-miR-24-1-5p URS0000232BE1_8665

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCCUACUGAGCUGAUAUCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus bta-miR-24
  2. Cavia porcellus (domestic guinea pig) cpo-miR-24-5p
  3. Cervus elaphus cel-miR-24
  4. Cricetulus griseus cgr-miR-24
  5. Dasypus novemcinctus dno-miR-24a-5p
  6. Gallus gallus (chicken) gga-miR-24-5p
  7. Macaca mulatta mml-miR-24-5p
  8. Macaca nemestrina (pig-tailed macaque) mne-miR-24-5p
  9. Mus musculus (house mouse) mmu-miR-24-1-5p
  10. Oryctolagus cuniculus ocu-miR-24-5p
  11. Pan paniscus (pygmy chimpanzee) ppa-miR-24-5p
  12. Pongo pygmaeus ppy-miR-24-5p
  13. Sus scrofa ssc-miR-24-2-5p
  14. Taeniopygia guttata (zebra finch) tgu-miR-24-5p