Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) cancer susceptibility 8 (CASC8) URS0000230AD4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CASC8: CASC8 is a long non-coding RNA (lncRNA) that has been studied in various types of cancer. It has been found to be down-regulated in bladder cancers and associated with advanced stages of bladder cancer [PMC5988895]. In pancreatic cancer, low expression of CASC8, along with other lncRNAs, was associated with improved overall survival [PMC9985641]. Genetic variants of the CASC8 gene have been identified and found to be in linkage disequilibrium [PMC7307370]. The relationship between a specific variant of CASC8 (rs10505477) and lung cancer susceptibility, platinum-based chemotherapy response, and toxicity has been evaluated [PMC4924002]. CASC8 has also been shown to affect the expression of miR-129a-5p in pancreatic cancer cells [PMC7699307]. In non-small cell lung cancer patients, the variant rs10505477 of CASC8 may be used to predict chemotherapy toxicity and response [PMC6930187]. Additionally, CASC8 has been identified as a risk lncRNA in low-risk groups for certain cancers [PMC9859148]. It is also expressed specifically in MII oocytes and is involved in the development of various human tumors [PMC5797088] [PMC7287184]. The expression levels of CASC8 have shown associations with treatment response in certain cancers such as pancreatic adenocarcinoma [PMC9740371] and colorectal cancer treated with L-OHP (oxaliplatin) chemotherapy [PMC4692059] . The expression of CASC8 can be silenced using Antisense LNATM GapmeRs technology[ PMC9379415].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAACCACCCCAGGCCCUUUGCACCUGCUAUUCCCUCUCCUCAGCAUGCUCUGCCCCAGACAAUUGCAAUGCUAACUUCUUACUUCCUUCAGGUUUCACUCAGAAAUGACUUUCUCAGUGGGGUCUCCCAUGACCAUUUUAUUUAAGAUUUCAACUACUUUGCCAGUAUUUCACUUCUCCUCCCUUGAUCUUUUCUUCCAAGCACUCACUGCCCUCUUGCACACUGUAUCUUUUACUUAUUUAUCUUGUUCAGUUUCUGCCUGCCUCACCUGCCUCACCACAGUGUACAUUUCACGAGGGCAGGGAUUUUGUCUGUUUUGUUGAUUGCUGUAGCCCUGGCAUCUUGGGCAGUGCCAGCACCUGUUAGCAUUAAAUACAUAUUUACUGAAUGAAUGAGUGGCUUCAUGCUUAAAAGCAAGAAGAGAGACCUUCAUAGAGAAGUAGGAAAAUGAAUUGUUGCACAAAUAAAGGGCCAUGUAAUGAGAGAGAGAGAGCAAGAGAAAGAGCAAACAAUUAAGGAGCAGCAGUGGCUUCCUGCAGGGGAGACCAAUGCCUUCUGUCCUCAGCGGAAACAGCUUGGCAUUCUUCCAAUUGAUGAAUGGCAUGGACCAGGAGCACUAGUUAUCUUCAGCUUCUGAGCAUCCGAAUAAAUAAACAUACAAAUGCAUAACAUAAAAUAAAUUCAAAUUACAAAUGAGAAAACCAAUCUAGGUUACCGGCAAGUCCUAUGACUUGAUGUGGAGGCCUGGAAGUGCAUCCUUGAAUCUUGCAAUGCAGUGAGCCAAGGAGCAAUGAGAGGCCACAUGAAUAACCGGGCCAGUGACAAGACACAUGUCCUCCUCCUUGCUGGUAUACACCAGAAUGCCCCGCAUGCAGCGAAUGCUCAAAAAGUGUUGGUGGAAGUGACAGAAUUCCAUCACCAUUAAACACAACCAGUGUUGCGGUUGACAAUGGCACUGAAGCAGGUGAAAAAUCCGUACAGCAGCUUCUGUCUUUGAAGAGUUUGCAGCCUCUUGAAGAGGGUUUAGAGGUUAAAAAAAGGACCCAGGCUGAUAGGGCCGCUACCAUUUGGAAAGUGACAAGAGGAAGAGAGAGAAUGAAACAACAGUAAGCACUGGCUCUCAGCUUCUACCUGAAGAGACAAACAUUGCUUUCACUUACAUUUCACUGGCCAAAUCAAGCCCAUGGCAACAAUUGAGUUCAAAAGCAUAAGGAGGUAUCUGGAAGGAAGAGAAUCAGAAAAUUUCUGAUGAGCCUCACUGACUACCUUCAGGGCAAAAAGGAAGAGAGGCACUCCAGAUCAGAGAUCUGCAUUGGAAACUCCUUGAGAACCAGAAGGGUAUGCUGUAUUUUUGUAACUGUGAGGAGCCCAGAAAGACUGAAGCCCAAAUAAAAUUCCUUUAUUCAAUAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications