Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 43 (SNORD43) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 43 (SNORD43) URS000022EFB6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD43: SNORD43 is a small nucleolar RNA (snoRNA) that is involved in the regulation of miRNA expression values [PMC9221658]. It is used as a normalization factor in the calculation of relative miRNA expression values using the 2−ΔΔCT method [PMC9221658]. In a study, 12 snoRNAs were identified, including 10 SNORDs (SNORD6, SNOTRD116-23, SNORD116-25, SNORD116-29, SNORD18A, SNORD42A, SNORD43, SNORD58C, SNORD60, and SNORD 101) and 2 SNORAs (SNORA3B and SNORA20) [PMC8742282]. These snoRNAs play important roles in various cellular processes such as RNA modification and ribosome biogenesis [PMC8742282].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACAGAUGAUGAACUUAUUGACGGGCGGACAGAAACUGUGUGCUGAUUGUCACGUUCUGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications