Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-451b URS000022EC48_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-451b: Hsa-mir-451b is a non-canonical mature form of hsa-miR-451b that shows sequence similarity with the 5′ portion of the hsa-miR-451a canonical mature form [PMC4666382]. It is significantly affected by blocking, unlike other miRNAs [PMC4666382]. Computational analysis suggests that the SARS-CoV-2 genome potentially associates with hsa-mir-451b, along with other miRNAs [PMC8620514]. Hsa-mir-451b is also involved in regulating four SNPs, potentially targeted by multiple miRNAs [PMC5899355]. Interestingly, hsa-mir-451b has been found to inhibit lung metastasis in osteosarcoma [PMC8211179]. However, there is no evidence of hsa-mir-451b in two specific datasets [PMC8211179]. In a study using TaqMan MicroRNA assays, hsa-mir-451b was included as one of the specific primer and probe mixes [PMC9858567]. It should be noted that within the same family, individual miRNAs are annotated with an additional one-letter suffix to differentiate them from each other [PMC4837569]. In summary, hsa-mir-451b is a non-canonical mature form of miRNA that shows sequence similarity with another canonical mature form and has been found to be significantly affected by blocking. It has been implicated in potential associations with SARS-CoV-2 and regulation of SNPs. Additionally, it has been shown to inhibit lung metastasis in osteosarcoma. However, there are no findings of its presence in specific datasets. Hsa-mir-451b was included as part of a specific primer and probe mix in a study using TaqMan MicroRNA assays.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAAGAGAACCAUUACCAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications