Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3909 URS000022B729_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3909: Hsa-mir-3909 is a microRNA that has been studied in relation to various diseases, including rheumatic heart disease (RHD) [PMC9409130]. In patients with RHD, the expression of hsa-mir-3909 is significantly downregulated in the plasma [PMC9409130]. This downregulation of hsa-mir-3909 enhances the IL1 pathway induced by interleukin 1 receptor type 1 (IL1R1), which is the target gene of hsa-mir-3909 [PMC9409130]. Hsa-mir-3909 has also been found to be correlated with rheumatic valvular heart disease [PMC8842963]. It has been shown that hsa-miR-205-3p and hsa-mir-3909 can target the IL-1β-IL-1 receptor pathway, leading to increased inflammation levels [PMC9781220]. Hsa-mir-3909 is located on 22q12.3, and deletions in this region have been associated with neurocristopathy and sensorineural hearing loss [PMC6442922]. In sepsis, hsa-mir-3909 has been identified as a potential regulator of prognosis along with other lncRNAs and miRNAs [PMC9976425]. Hsa-miR-205-3p and hsa-mir-3909 have also been implicated in disease progression, specifically in augmenting the IL1 pathway [PMC8282907]. The expression levels of these miRNAs can be quantified using real-time qPCR techniques [PMC8156444]. The target genes of hsa-miR-205-3p and hsa-mir-3909 include IL-1β and IL1R1 [PMC5857082]. The altered expression of hsa-miR-205-3p and hsa-mir-3909 has been specifically observed in RHD, potentially leading to increased expression of IL-1β and IL1R1 [PMC5857082].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUCCUCUAGGGCCUGCAGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications