Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-7b-3p URS0000224ED9_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-7b: Mmu-mir-7b is a miRNA that belongs to the intergenic subtype [PMC4010735]. Primers were used to generate seed sequences for mmu-mir-7b [PMC5595954]. Mmu-mir-7b is one of the miRNAs that showed differential expression in a study [PMC6209654]. It is also one of the overexpressed miRNAs in the study, along with mmu-miR-669g, mmu-miR-222, mmu-miR-708, mmu-miR-26a, mmu-miR-1898, and mmu-miR-500 [PMC6209654]. Mmu-mir-7b has experimentally validated target genes [PMC6209654]. Mmu-mir-7a-1 is another miRNA gene that is embedded within an intron of the gene encoding for Hnrnpk [PMC3362837]. The study characterized elements within the upstream regulatory sequences of both mmu-mir-7a-2 and mmu-mir-7b [PMC3362837].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAACAAGUCACAGCCAGCCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications