Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-1224 URS0000224406_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-1224: Rno-mir-1224 is a microRNA that has been found to have a complementary binding site for circRNA_7025 [PMC9412201]. Overexpression of circRNA_7025 has been shown to reduce neuronal apoptosis induced by OGD, and this effect is partly suppressed by treatment with rno-mir-1224 [PMC9412201]. Rno-mir-1224 has been reported to be involved in neuronal apoptosis, suggesting its potential role in LSRA by regulating neuronal apoptosis [PMC9412201]. Additionally, rno-mir-1224 is one of the miRNAs that could act as a mitigation target for neuropathic pain by targeting and inhibiting the Wnt signaling pathway [PMC6753853]. A network of circRNAs, miRNAs, and mRNAs targeting rno-mir-1224 has been illustrated using Cytoscape software [PMC9412201]. Rno-mir-1224 is one of the miRNAs that showed similar expression changes in both SL and PH groups at the same postoperative time point, suggesting its potential role in pain regulation [PMC4198680]. To validate the differential expression of rno-mir-1224 and other miRNAs, qPCR analysis was performed in SNI and sham-operated rats [PMC6753853].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAGGACUGGGGAGGUGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Cricetulus griseus cgr-miR-1224
  2. Mus musculus (house mouse) mmu-miR-1224-5p
Publications