Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-410-5p URS00002233F4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-410: Hsa-mir-410 is a microRNA that has been studied in various contexts. Reverse transcription quantitative real-time PCR was used to confirm the array results for hsa-mir-410 [PMC5288148]. It was found that a large group of miRNAs, including hsa-mir-410, were associated with extracellular matrix (ECM) related functions [PMC3404966]. Primers for miRNA quantification were used for hsa-mir-410 [PMC4182719]. Additionally, hsa-mir-410 was found to be involved in a pathway for cancer drug resistance by drug efflux [PMC9524264]. Hsa-mir-410 was also analyzed alongside other miRNAs in various studies [PMC9270956] [PMC8452524] [PMC9877296]. Hsa-mir-410 is a microRNA that has been studied using reverse transcription quantitative real-time PCR to confirm array results and analyze its involvement in various functions and pathways. It has been found to be associated with ECM related functions and cancer drug resistance by drug efflux. Hsa-mir-410 has also been analyzed alongside other miRNAs in different studies.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGUUGUCUGUGAUGAGUUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-410-5p
  2. Cricetulus griseus cgr-miR-410-5p
  3. Macaca mulatta (Rhesus monkey) mml-miR-410-5p
  4. Mus musculus (house mouse) mmu-miR-410-5p
  5. Oryctolagus cuniculus ocu-miR-410-5p
  6. Pteropus alecto (black flying fox) pal-miR-410-5p
  7. Rattus norvegicus (Norway rat) rno-miR-410-5p
Publications