Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-188 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-188 precursor URS0000221C26_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR188: MIR188 is a microRNA that is up-regulated in aged mice and humans and has been found to play a role in bone metabolism [PMC6158877]. It directly targets histone deacetylase 9 (Hdac9) and RPTOR independent companion of MTOR complex 2 (Rictor) mRNAs [PMC6158877]. Overexpression of MIR188 in osteoprogenitors leads to age-associated bone loss and fat accumulation in bone marrow, while mice lacking MIR188 show a decrease in age-associated bone loss and fat accumulation [PMC6158877]. The copy number and DNA methylation level at the MIR188 locus are minimally altered in STAD samples [PMC6537442]. The region upstream of the MIR188 locus contains several signal transducer and activator of transcription (STAT) binding sites, suggesting potential regulatory elements [PMC6537442]. Synthetic oligo RNAs targeting MIR188 were used for experimental purposes [PMC6353185]. MIR188 is specifically enriched in neurons but down-regulated in astrocytes [PMC6434090]. Real-time PCR was used to analyze the expression levels of GAPDH, Bcl-2, and MIR188 genes [PMC5242199]. Additionally, MIR188 has been implicated in Hcy-induced cardiac remodeling [PMC5147974]. Knocking out MIR188 reduces age-related cortical bone loss, trabecular bone loss, and marrow fat deposition in mice models [PMC8327488]. The genomic location of the rat MIR188 gene was determined to be upstream from the Clcn5 gene on the X-chromosome [PMC5052619]. miR532 inhibits TERT expression while miR168, miR397, and MIR188 are enhanced or suppressed depending on the plant species studied [PMC8253104] . Finally, miR130a and miR149-3p promote osteogenic differentiation while MIR188 is involved in the age-related switch to adipogenesis in BMSCs [PMC9391248].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUCCCUCUCUCACAUCCCUUGCAUGGUGGAGGGUGAGCUUUCUGAAAACCCCUCCCACAUGCAGGGUUUGCAGGAUGGCGAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

2D structure Publications