Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-205 URS0000220D63_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-205: Rno-mir-205 is a microRNA that has been shown to be upregulated in rats [PMC8900362]. In a study examining the expression of various miRNAs in the stomach, rno-mir-205 was found to be downregulated [PMC6538193]. Rno-mir-205 has been implicated in the induction of apoptosis, along with other miRNAs such as rno-miR-132-3p and rno-miR-146b-5p [PMC5102036]. It has also been associated with the upregulation of the protein kinase B signaling cascade and the downregulation of NF-kB transcription factor activity [PMC5102036]. Rno-mir-205 is predicted to bind to lncRNA Vof-16 along with other miRNAs such as rno-miR-346 and rno-miR-874-3p [PMC8451561]. In a study comparing sham laparotomy and partial hepatectomy, rno-mir-205 was found to be significantly deregulated due to sham laparotomy but unaffected following partial hepatectomy [PMC4198680]. Rno-mir-205 has also been reported to be involved in diabetic complications, along with other miRNAs such as rno-miR1 3p and rno-miR9a 3p [PMC6097669]. Overall, these studies highlight the potential role of rno-mir 205 in various biological processes and disease conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUUCAUUCCACCGGAGUCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

Publications