Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-449c-5p URS00002198F3_9606

Automated summary: This miRNA sequence is 25 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (TarBase, miRBase, LncBase, RefSeq, ENA, IntAct, GeneCards, MalaCards). Described in 16 papers. Homo sapiens (human) hsa-miR-449c-5p sequence is a product of miR-449c, hsa-miR-449c, miR-449, hsa-miR-449c-5p, MIR449C, miR-449c-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 2310047H23Rik, A2D, A2lp, ABCA5, ACSBG2, ADAP1, ADPRT, ADTB2, AF15Q14, AF4p12.

Interactions 2

According to IntAct, Homo sapiens (human) hsa-miR-449c-5p interacts with:

Interaction id Participant Synonyms
EBI-11709694 intact:EBI-11709120 EBI-11709120 lnc_arsr
EBI-11785328 intact:EBI-11709120 EBI-11709120 lnc_arsr

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGGCAGUGUAUUGCUAGCGGCUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 2 other species