Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1443 SNR82 secondary structure diagram

Saccharomyces cerevisiae YJM1443 SNR82 URS00002155A1_1294373

Automated summary: This snoRNA sequence is 268 nucleotides long and is found in Saccharomyces cerevisiae YJM1443. Annotated by 1 database (ENA). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR82, RF01261).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUGGCUCUUCAACACAUUUCAACAUGUUCAAGUAAUUUGUGUUAGUGGAUGACCAUUUAGGGGCUGCUGGCCUGGUUACCGGGAGUUUUUCUUGGAUCCAAGCUAGCUUUUCCGUCUGAUUAUCCUUAAGCUUCACAAAUUACAAUUUUUCCCACGCAUUAAGAAAUAAGCUCAAGAUGCCUAAAAUAAGUUCUAUCCCGCCUUUUUUCGCUAACAAUGACUGAGUAUUCCCACAGUCUAUAGUUUGAUAGUAGAUGGGCGGAAAUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 48 other species

    1. Saccharomyces cerevisiae AWRI796 Small nucleolar RNA snR82
    2. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR82
    3. Saccharomyces cerevisiae P283 SNR82
    4. Saccharomyces cerevisiae P301 SNR82
    5. Saccharomyces cerevisiae R008 SNR82
    6. Saccharomyces cerevisiae R103 SNR82
    7. Saccharomyces cerevisiae S288C Small Nucleolar RNA
    8. Saccharomyces cerevisiae YJM1129 SNR82
    9. Saccharomyces cerevisiae YJM1199 SNR82
    10. Saccharomyces cerevisiae YJM1202 SNR82
    11. Saccharomyces cerevisiae YJM1252 SNR82
    12. Saccharomyces cerevisiae YJM1311 SNR82
    13. Saccharomyces cerevisiae YJM1326 SNR82
    14. Saccharomyces cerevisiae YJM1332 SNR82
    15. Saccharomyces cerevisiae YJM1336 SNR82
    16. Saccharomyces cerevisiae YJM1341 SNR82
    17. Saccharomyces cerevisiae YJM1381 SNR82
    18. Saccharomyces cerevisiae YJM1383 SNR82
    19. Saccharomyces cerevisiae YJM1386 SNR82
    20. Saccharomyces cerevisiae YJM1387 SNR82
    21. Saccharomyces cerevisiae YJM1415 SNR82
    22. Saccharomyces cerevisiae YJM1417 SNR82
    23. Saccharomyces cerevisiae YJM1463 SNR82
    24. Saccharomyces cerevisiae YJM1477 SNR82
    25. Saccharomyces cerevisiae YJM1526 SNR82
    26. Saccharomyces cerevisiae YJM1549 SNR82
    27. Saccharomyces cerevisiae YJM1615 SNR82
    28. Saccharomyces cerevisiae YJM189 SNR82
    29. Saccharomyces cerevisiae YJM244 SNR82
    30. Saccharomyces cerevisiae YJM248 SNR82
    31. Saccharomyces cerevisiae YJM320 SNR82
    32. Saccharomyces cerevisiae YJM428 SNR82
    33. Saccharomyces cerevisiae YJM453 SNR82
    34. Saccharomyces cerevisiae YJM541 SNR82
    35. Saccharomyces cerevisiae YJM681 SNR82
    36. Saccharomyces cerevisiae YJM682 SNR82
    37. Saccharomyces cerevisiae YJM683 SNR82
    38. Saccharomyces cerevisiae YJM689 SNR82
    39. Saccharomyces cerevisiae YJM969 SNR82
    40. Saccharomyces cerevisiae YJM972 SNR82
    41. Saccharomyces cerevisiae YJM975 SNR82
    42. Saccharomyces cerevisiae YJM978 SNR82
    43. Saccharomyces cerevisiae YJM981 SNR82
    44. Saccharomyces cerevisiae YJM984 SNR82
    45. Saccharomyces cerevisiae YJM987 SNR82
    46. Saccharomyces cerevisiae YJM990 SNR82
    47. Saccharomyces cerevisiae YJM993 SNR82
    48. Saccharomyces cerevisiae YJM996 SNR82
    2D structure New