Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-30b-3p URS00002152A8_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (RefSeq, LncBase, GeneCards, ENA, MalaCards, TarBase, MirGeneDB, miRBase). Described in 49 papers. Homo sapiens (human) hsa-miR-30b-3p sequence is a product of miR-30, miR-30b-3p, miR-30b, hsa-miR-30b-3p, hsa-miR-30b, MIR30B genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 4EHP, A121, A1S9T, A4, A4-LSB, AAAT, AATF, ABC28, ABCF2, ABP620.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUGGGAGGUGGAUGUUUACUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Alligator mississippiensis ami-miR-30b-3p
    2. Bos taurus (cattle) Bta-Mir-30-P2c_3p* (star (passenger))
    3. Canis lupus familiaris Cfa-Mir-30-P2c_3p* (star (passenger))
    4. Capra hircus chi-miR-30b-3p
    5. Chrysemys picta bellii Cpi-Mir-30-P2c_3p* (star (passenger))
    6. Chrysemys picta (Painted turtle) cpi-miR-30b-3p
    7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30b-3p
    8. Macaca mulatta mml-miR-30b-3p
    9. Monodelphis domestica mdo-miR-30b-3p
    10. Sarcophilus harrisii Sha-Mir-30-P2c_3p* (star (passenger))