v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-136 precursor URS00002130B2_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGCCCUCGGAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUAUGCUCCAUCAUCGUCUCAAAUGAGUCUUCAGAGGGUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Aotus nancymaae miRNA (ENSANAG00000006478.1)
  2. Cebus imitator (Panamanian white-faced capuchin) microRNA 136 (ENSCCAG00000009038.1)
  3. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000011139.1)
  4. Chlorocebus sabaeus microRNA mir-136
  5. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000010234.1)
  6. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-136 (ENSGGOG00000033627.2)
  7. Gorilla gorilla microRNA ggo-mir-136 precursor
  8. Homo sapiens microRNA hsa-mir-136 precursor
  9. Macaca mulatta (Rhesus monkey) microRNA mir-136
  10. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000013941.1)
  11. Mandrillus leucophaeus miRNA (ENSMLEG00000003117.1)
  12. Microcebus murinus microRNA 136 (ENSMICG00000019423.3)
  13. Otolemur garnettii microRNA mir-136
  14. Pan troglodytes microRNA ptr-mir-136 precursor
  15. Papio anubis microRNA mir-136
  16. Pongo abelii microRNA mir-136
  17. Pongo pygmaeus microRNA ppy-mir-136 precursor
  18. Propithecus coquereli miRNA (ENSPCOG00000010257.1)
  19. Rhinopithecus bieti miRNA (ENSRBIG00000010078.1)
  20. Rhinopithecus roxellana miRNA (ENSRROG00000026520.1)
  21. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000001273.1)
 Publications