Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-136 precursor URS00002130B2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR136: MIR136 is a microRNA that plays a role in the proliferation and differentiation of preadipocytes. After preadipocytes successfully differentiate into mature adipocytes, the expression of PPARGC1B decreases, while the level of MIR136 increases [PMC9928478]. The regulatory mechanism of MIR136 involves the function of PPARGC1B, PPARγ, C/EBPα, and IGF1 [PMC9928478]. MIR136 is a small non-coding RNA molecule that regulates gene expression at the post-transcriptional level. It has been found to be involved in various biological processes, including adipogenesis [PMC9928478]. In the context of preadipocyte differentiation into mature adipocytes, MIR136 levels increase while PPARGC1B expression decreases [PMC9928478]. The role of MIR136 in preadipocyte proliferation and differentiation has been investigated. It is suggested that MIR136 may regulate these processes through its interaction with key transcription factors involved in adipogenesis, such as PPARγ and C/EBPα [PMC9928478]. Additionally, IGF1 may also be involved in the regulatory mechanism of MIR136 during preadipocyte differentiation [PMC9928478]. In summary, MIR136 is a microRNA that plays a role in regulating preadipocyte proliferation and differentiation. Its expression increases during adipogenesis while PPARGC1B levels decrease. The regulatory mechanism involves interactions with key transcription factors such as PPARγ and C/EBPα as well as potential involvement of IGF1 [PMC9928478].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGCCCUCGGAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUAUGCUCCAUCAUCGUCUCAAAUGAGUCUUCAGAGGGUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

Publications