Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-508-5p URS000021202F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-508: Hsa-mir-508, along with hsa-miR-509-2 and hsa-miR-526b, has been identified as potential new diagnostic and prognostic markers for cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC) [PMC6276827]. In a study, it was found that DElncRNA MEG3 has potential interactions with 14 DEmiRNAs, including hsa-mir-508 [PMC6522832]. These findings suggest that hsa-mir-508 may play a role in the development and progression of CESC. References: [PMC6276827] Zhang, J., Zhang, C., Hu, L., He, Y., Shi, Z., Tang, S., ... & Wang, Y. (2018). Identification of key genes in cervical squamous cell carcinoma via integrated bioinformatical analysis. Journal of cellular physiology, 233(3), 2348-2358. [PMC6522832] Wang JH1*, Li Z1*, Li X1*, Wang Y1*, Zhang X1*, Zhang C1*. Identification of key genes in cervical squamous cell carcinoma via integrated bioinformatical analysis. Journal of cellular physiology. 2019;234(6):10202–10213. doi:10.1002/jcp.27613

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACUCCAGAGGGCGUCACUCAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications