Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-376b-5p URS000020F6B2_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-376b: Mmu-mir-376b is a microRNA that has been extensively studied in various contexts [PMC5372868]. In the miRWalk database, it is one of the six miRNAs, along with mmu-miR-615, mmu-miR-124, mmu-let-7e, mmu-miR-708, and mmu-miR-879, that have a total of 349 validated target genes [PMC5372868]. In the livers of LPD offspring, mmu-mir-376b is significantly downregulated [PMC5372868]. Mmu-mir-376b has been found to have a preferential editing site and has been shown to be edited in the adult brain [PMC2500034] [PMC3409261]. In rodents subjected to perinatal protein malnutrition, there is a reduction in the expression of mmu-mir-376b at 21 days [PMC9127546]. Mmu-mir-376b is also associated with other transcription factors for the regulation of common targets within each regulation network [PMC4531287]. Additionally, there is a human cluster that corresponds to the mouse cluster containing mmu-mir-376a and mmu-mir-376b [PMC1315341].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGGAUAUUCCUUCUAUGGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Rattus norvegicus rno-miR-376b-5p
Publications