Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays zma-miR156c URS000020F5A7_4577

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Zea mays. Annotated by 3 databases (miRBase, ENA, RefSeq). Described in 5 papers. Zea mays zma-miR156c sequence is a product of MIR156b, zma-miR156b-5p, MIR156e, miR156b, zma-miR156i-5p, zma-miR156d, miR156i, zma-miR156a-5p, miR156h, MIR156g, miR156, miR156h-5p, MIR156i, MIR156a, zma-miR156g, miR156g-5p, miR156i-5p, zma-miR156b, zma-miR156l, MIR156f, MIR156l, miR156a, zma-miR156f, zma-miR156a, miR156l-5p, zma-miR156h-5p, MIR156h, miR156d-5p, miR156f-5p, miR156f, zma-miR156i, miR156b-5p, zma-miR156f-5p, miR156g, miR156l, zma-miR156g-5p, zma-miR156l-5p, zma-miR156h, MIR156d, zma-miR156e, zma-miR156d-5p, miR156a-5p, miR156e-5p, miR156d, miR156e, zma-miR156e-5p genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGACAGAAGAGAGUGAGCAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 114 other species

    1. Aegilops tauschii ata-miR156a-5p
    2. Amborella trichopoda atr-miR156b
    3. Ananas comosus (pineapple) microRNA 156i
    4. Arabidopsis lyrata aly-miR156d-5p
    5. Arabidopsis thaliana ath-miR156f-5p
    6. Asparagus officinalis (garden asparagus) aof-miR156a
    7. Brachypodium distachyon (stiff brome) bdi-miR156c
    8. Brassica napus bna-miR156f
    9. Brassica rapa (field mustard) bra-miR156b-5p
    10. Camelina sativa (false flax) cas-miR156c-5p
    11. Carica papaya cpa-miR156d
    12. Citrus sinensis (sweet orange) csi-miR156a-5p
    13. Citrus trifoliata ctr-miR156
    14. Cucumis melo cme-miR156c
    15. Cynara cardunculus cca-miR156a
    16. Digitalis purpurea (common foxglove) dpr-miR156b
    17. Eucalyptus globulus MICRORNA156.5
    18. Fragaria vesca subsp. vesca fve-miR156d
    19. Glycine max gma-miR156y
    20. Gossypium hirsutum (cotton) ghr-miR156d
    21. Helianthus annuus han-miR156a
    22. Helianthus argophyllus har-miR156a
    23. Helianthus tuberosus htu-miR156a
    24. Linum usitatissimum lus-miR156g
    25. Malus domestica (apple) mdm-miR156o
    26. Manihot esculenta (cassava) mes-miR156e
    27. Medicago truncatula mtr-miR156i-5p
    28. Nicotiana tabacum nta-miR156d
    29. Ophiorrhiza prostrata miRNA-156a
    30. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR156b-5p
    31. Oryza sativa osa-miR156h-5p
    32. Physcomitrium patens ppt-miR156a
    33. Picea abies (Norway spruce) pab-miR156a
    34. Populus tomentosa Pto-miR156b
    35. Populus trichocarpa ptc-miR156f
    36. Prunus persica (peach) ppe-miR156e
    37. Rauvolfia tetraphylla miRNA-156a
    38. Rosa chinensis ath-miR156a-5p
    39. Saccharum officinarum sof-miR156
    40. Solanum lycopersicum sly-miR156d-5p
    41. Solanum tuberosum (potato) stu-miR156e
    42. Sorghum bicolor sbi-miR156g
    43. Theobroma cacao (cacao) tcc-miR156d
    44. Tinospora cordifolia miRNA-156a
    45. Triticum aestivum tae-csmR156-1
    46. Vigna unguiculata vun-miR156a
    47. Vitis vinifera (wine grape) vvi-miR156c
    48. Vriesea carinata vca-miR156a-5p