Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR156b-5p URS000020F5A7_39947

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Described in 1 paper. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR156b-5p sequence is a product of miR156c, osa-miR156j, osa-miR156a, miR156h-5p, miR156b-5p, osa-miR156f-5p, osa-miR156e, osa-miR156c, osa-miR156i, miR156e, osa-miR156c-5p, miR156d, osa-miR156g-5p, osa-miR156f, miR156j-5p, miR156j, osa-miR156h, osa-miR156j-5p, miR156f-5p, miR156f, miR156c-5p, miR156g-5p, osa-miR156h-5p, osa-miR156d, miR156i, osa-miR156b, miR156a, miR156, miR156b, miR156g, osa-miR156b-5p, osa-miR156g, miR156h genes. Found in the japanese rice reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGACAGAAGAGAGUGAGCAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 47 other species

    1. Aegilops tauschii ata-miR156b-5p
    2. Amborella trichopoda atr-miR156d
    3. Ananas comosus (pineapple) microRNA 156i
    4. Arabidopsis lyrata aly-miR156b-5p
    5. Arabidopsis thaliana ath-miR156e
    6. Asparagus officinalis (garden asparagus) aof-miR156a
    7. Brachypodium distachyon (stiff brome) bdi-miR156e-5p
    8. Brassica napus bna-miR156d
    9. Brassica rapa (field mustard) bra-miR156b-5p
    10. Camelina sativa cas-miR156d-5p
    11. Carica papaya (papaya) cpa-miR156d
    12. Citrus sinensis (sweet orange) csi-miR156b-5p
    13. Citrus trifoliata ctr-miR156
    14. Cucumis melo (muskmelon) cme-miR156c
    15. Cynara cardunculus cca-miR156a
    16. Digitalis purpurea dpr-miR156b
    17. Eucalyptus globulus MICRORNA156.5
    18. Fragaria vesca subsp. vesca fve-miR156d
    19. Glycine max (soybean) gma-miR156h
    20. Gossypium hirsutum (cotton) ghr-miR156a
    21. Helianthus annuus (common sunflower) han-miR156b
    22. Helianthus argophyllus har-miR156a
    23. Helianthus tuberosus htu-miR156a
    24. Linum usitatissimum lus-miR156g
    25. Malus domestica mdm-miR156j
    26. Manihot esculenta mes-miR156e
    27. Medicago truncatula mtr-miR156c-5p
    28. Nicotiana tabacum nta-miR156a
    29. Ophiorrhiza prostrata miRNA-156a
    30. Oryza sativa (rice) osa-miR156a
    31. Physcomitrium patens ppt-miR156a
    32. Picea abies (Norway spruce) pab-miR156a
    33. Populus tomentosa Pto-miR156b
    34. Populus trichocarpa ptc-miR156e
    35. Prunus persica ppe-miR156c
    36. Rauvolfia tetraphylla miRNA-156a
    37. Rosa chinensis ath-miR156a-5p
    38. Saccharum officinarum sof-miR156
    39. Solanum lycopersicum (tomato) sly-miR156d-5p
    40. Solanum tuberosum (potato) stu-miR156i-5p
    41. Sorghum bicolor (sorghum) sbi-miR156g
    42. Theobroma cacao tcc-miR156g
    43. Tinospora cordifolia miRNA-156a
    44. Triticum aestivum tae-csmR156-1
    45. Vigna unguiculata vun-miR156a
    46. Vitis vinifera (wine grape) vvi-miR156b
    47. Vriesea carinata vca-miR156a-5p
    48. Zea mays zma-miR156b-5p