Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tinospora cordifolia miRNA-156a URS000020F5A7_285590

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Tinospora cordifolia. Annotated by 1 database (ENA).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGACAGAAGAGAGUGAGCAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 48 other species

    1. Aegilops tauschii ata-miR156a-5p
    2. Amborella trichopoda atr-miR156d
    3. Ananas comosus (pineapple) microRNA 156i
    4. Arabidopsis lyrata aly-miR156f-5p
    5. Arabidopsis thaliana ath-miR156b-5p
    6. Asparagus officinalis (garden asparagus) aof-miR156a
    7. Brachypodium distachyon (stiff brome) bdi-miR156e-5p
    8. Brassica napus (rape) bna-miR156d
    9. Brassica rapa bra-miR156f-5p
    10. Camelina sativa (false flax) cas-miR156f-5p
    11. Carica papaya (papaya) cpa-miR156b
    12. Citrus sinensis csi-miR156b-5p
    13. Citrus trifoliata ctr-miR156
    14. Cucumis melo (muskmelon) cme-miR156a
    15. Cynara cardunculus cca-miR156a
    16. Digitalis purpurea dpr-miR156b
    17. Eucalyptus globulus MICRORNA156.5
    18. Fragaria vesca subsp. vesca fve-miR156d
    19. Glycine max gma-miR156a
    20. Gossypium hirsutum ghr-miR156a
    21. Helianthus annuus han-miR156a
    22. Helianthus argophyllus har-miR156a
    23. Helianthus tuberosus htu-miR156a
    24. Linum usitatissimum (flax) lus-miR156g
    25. Malus domestica mdm-miR156j
    26. Manihot esculenta (cassava) mes-miR156g
    27. Medicago truncatula (barrel medic) mtr-miR156b-5p
    28. Nicotiana tabacum (common tobacco) nta-miR156d
    29. Ophiorrhiza prostrata miRNA-156a
    30. Oryza sativa Japonica Group microRNA osa-miR156b-5p
    31. Oryza sativa (rice) osa-miR156d
    32. Physcomitrium patens ppt-miR156b
    33. Picea abies (Norway spruce) pab-miR156a
    34. Populus tomentosa Pto-miR156b
    35. Populus trichocarpa ptc-miR156a
    36. Prunus persica (peach) ppe-miR156c
    37. Rauvolfia tetraphylla miRNA-156a
    38. Rosa chinensis ath-miR156a-5p
    39. Saccharum officinarum sof-miR156
    40. Solanum lycopersicum sly-miR156d-5p
    41. Solanum tuberosum (potato) stu-miR156k-5p
    42. Sorghum bicolor (sorghum) sbi-miR156c
    43. Theobroma cacao tcc-miR156g
    44. Triticum aestivum tae-csmR156-1
    45. Vigna unguiculata vun-miR156a
    46. Vitis vinifera vvi-miR156d
    47. Vriesea carinata vca-miR156a-5p
    48. Zea mays zma-miR156e-5p