Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-218a URS000020D84A_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-218a: Oar-mir-218a is a microRNA that has been studied in various contexts. In a study comparing different time points, it was found that oar-mir-218a showed no change at 3 dpi compared to 0 dpi, but it was upregulated 9-fold at 5 dpi compared to 3 dpi [PMC6893480]. Another study found that oar-mir-218a mRNA was lower in pregnancy groups compared to cyclic groups [PMC9428447]. CTNNB1 was identified as one of the hub genes targeted by oar-mir-218a [PMC9428447]. Oar-miR-1185-3p and oar-mir-218a were detected as regulated miRNAs in ovine plasma samples [PMC9428447]. Oar-mir-218a has been reported as an early pregnancy marker of extracellular vesicles in ovine serum [PMC9428447]. In a comparison between different time points, oar-mir-218a was found to be downregulated between C16 and P16 [PMC9428447]. In another study, it was observed that oar-mir-218a was upregulated compared to the PGA library [PMC7142988]. Oar-miR-377 and oar-miR-200 families were upregulated in later stages of pregnancy, while oar-miR106a and oarmiR-218a were downregulated [PMC6251998]. Oarmir - 218 a is one of the top three differentially expressed miRNAs when comparing PL vs. EL samples [PMC9679157]. In the context of sheep hypothalamus, several mRNA–miRNA pairs involving oarmiR - 21 8 a were identified, including PRL regulated by this microRNA[ PMC6974689 ]. Finally, highly expressed miRNAs, including oar-mir-218a, have been shown to play important roles in regulating GnRH release [PMC9222358].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGUGCUUGAUCUAACCAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Alligator mississippiensis (American alligator) ami-miR-218-5p
  2. Anolis carolinensis (green anole) Aca-Mir-218-P4_5p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-218
  4. Bos taurus Bta-Mir-218-P4_5p (mature (guide))
  5. Callithrix jacchus cja-miR-218
  6. Canis lupus familiaris (dog) cfa-miR-218
  7. Capra hircus chi-miR-218
  8. Cavia porcellus (domestic guinea pig) Cpo-Mir-218-P4_5p (mature (guide))
  9. Cervus elaphus cel-miR-218
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-218-P4_5p (mature (guide))
  11. Columba livia (rock pigeon) cli-miR-218-5p
  12. Dasypus novemcinctus Dno-Mir-218-P4_5p (mature (guide))
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-218-P4_5p (mature (guide))
  14. Equus caballus (horse) eca-miR-218
  15. Gallus gallus (chicken) gga-miR-218-5p
  16. Gekko japonicus Gja-Mir-218-P4_5p (mature (guide))
  17. Gorilla gorilla gorilla ggo-miR-218 (MIR218)
  18. Gorilla gorilla ggo-miR-218
  19. Homo sapiens (human) hsa-miR-218-5p
  20. Lagothrix lagotricha lla-miR-218
  21. Lemur catta (Ring-tailed lemur) lca-miR-218
  22. Macaca mulatta (Rhesus monkey) mml-miR-218-5p
  23. Macaca nemestrina mne-miR-218
  24. Microcaecilia unicolor Mun-Mir-218-P2_5p (mature (guide))
  25. Monodelphis domestica mdo-miR-218-5p
  26. Mus musculus (house mouse) mmu-miR-218-5p
  27. Ornithorhynchus anatinus oan-miR-218-5p
  28. Oryctolagus cuniculus (rabbit) Ocu-Mir-218-P4_5p (mature (guide))
  29. Oryzias latipes (Japanese medaka) ola-miR-218a
  30. Pan paniscus (pygmy chimpanzee) ppa-miR-218
  31. Pan troglodytes ptr-miR-218
  32. Pongo pygmaeus (Bornean orangutan) ppy-miR-218
  33. Pteropus alecto (black flying fox) pal-miR-218-5p
  34. Python bivittatus (Burmese python) pbv-miR-218-5p
  35. Rattus norvegicus rno-miR-218a-5p
  36. Saguinus labiatus (red-chested mustached tamarin) sla-miR-218
  37. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-218-P4_5p (mature (guide))
  38. Sphenodon punctatus Spt-Mir-218-P4_5p (mature (guide))
  39. Sus scrofa ssc-miR-218-5p
  40. Taeniopygia guttata (zebra finch) tgu-miR-218-5p
  41. Tupaia chinensis tch-miR-218-5p
  42. Xenopus tropicalis xtr-miR-218
Publications