Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-218-5p URS000020D84A_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (MirGeneDB, miRBase, TarBase, GeneCards, MalaCards, RefSeq, ENA, LncBase, PSICQUIC). Homo sapiens (human) hsa-miR-218-5p sequence is a product of MIR218-2, hsa-miR-218-5p, 218-2, hsa-miR-218, 218-1, mir-218-2, MIR218-1, miR-218, miR-218-5p, mir-218-1 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 14-3-3-zeta, 15E1.2, 16A, 182-FIP, 2'-PDE, 239FB, 2OST, 3-PAP, 3635.

Interactions 16

According to PSICQUIC, Homo sapiens (human) hsa-miR-218-5p interacts with:

Interaction id Participant Synonyms
URS000020D84A_9606-8 O75044 O75044
URS000020D84A_9606-0 O75044 O75044
URS000020D84A_9606-9 P00533 P00533
URS000020D84A_9606-5 P00533 P00533
URS000020D84A_9606-6 P02452 P02452
URS000020D84A_9606-10 P02452 P02452
URS000020D84A_9606-11 P08047 P08047
URS000020D84A_9606-7 P08047 P08047
URS000020D84A_9606-12 P51608 P51608
URS000020D84A_9606-1 P51608 P51608
URS000020D84A_9606-13 Q8NFP9 Q8NFP9
URS000020D84A_9606-2 Q8NFP9 Q8NFP9
URS000020D84A_9606-14 Q9HCK4 Q9HCK4
URS000020D84A_9606-3 Q9HCK4 Q9HCK4
URS000020D84A_9606-4 Q9Y6N7 Q9Y6N7
URS000020D84A_9606-15 Q9Y6N7 Q9Y6N7

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUGUGCUUGAUCUAACCAUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 41 other species

    1. Alligator mississippiensis ami-miR-218-5p
    2. Anolis carolinensis (green anole) Aca-Mir-218-P4_5p (mature (guide))
    3. Ateles geoffroyi age-miR-218
    4. Bos taurus Bta-Mir-218-P4_5p (mature (guide))
    5. Callithrix jacchus cja-miR-218
    6. Canis lupus familiaris cfa-miR-218
    7. Capra hircus (goat) chi-miR-218
    8. Cavia porcellus Cpo-Mir-218-P4_5p (mature (guide))
    9. Cervus elaphus (red deer) cel-miR-218
    10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-218-P4_5p (mature (guide))
    11. Columba livia (rock pigeon) cli-miR-218-5p
    12. Dasypus novemcinctus Dno-Mir-218-P4_5p (mature (guide))
    13. Echinops telfairi Ete-Mir-218-P4_5p (mature (guide))
    14. Equus caballus (horse) eca-miR-218
    15. Gallus gallus (chicken) gga-miR-218-5p
    16. Gekko japonicus Gja-Mir-218-P4_5p (mature (guide))
    17. Gorilla gorilla ggo-miR-218
    18. Lagothrix lagotricha (brown woolly monkey) lla-miR-218
    19. Lemur catta lca-miR-218
    20. Macaca mulatta (Rhesus monkey) mml-miR-218-5p
    21. Macaca nemestrina (pig-tailed macaque) mne-miR-218
    22. Microcaecilia unicolor Mun-Mir-218-P2_5p (mature (guide))
    23. Monodelphis domestica mdo-miR-218-5p
    24. Mus musculus mmu-miR-218-5p
    25. Ornithorhynchus anatinus oan-miR-218-5p
    26. Oryctolagus cuniculus Ocu-Mir-218-P4_5p (mature (guide))
    27. Oryzias latipes (Japanese medaka) ola-miR-218a
    28. Ovis aries oar-miR-218a
    29. Pan paniscus ppa-miR-218
    30. Pan troglodytes ptr-miR-218
    31. Pongo pygmaeus (Bornean orangutan) ppy-miR-218
    32. Pteropus alecto (black flying fox) pal-miR-218-5p
    33. Python bivittatus (Burmese python) pbv-miR-218-5p
    34. Rattus norvegicus rno-miR-218a-5p
    35. Saguinus labiatus sla-miR-218
    36. Sarcophilus harrisii Sha-Mir-218-P4_5p (mature (guide))
    37. Sphenodon punctatus Spt-Mir-218-P4_5p (mature (guide))
    38. Sus scrofa (pig) ssc-miR-218-5p
    39. Taeniopygia guttata tgu-miR-218-5p
    40. Tupaia chinensis tch-miR-218-5p
    41. Xenopus tropicalis (tropical clawed frog) xtr-miR-218
    Publications New