Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-218-5p URS000020D84A_9031

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (ENA, MirGeneDB, RefSeq, miRBase). Gallus gallus (chicken) gga-miR-218-5p sequence is a product of MIR218-2, miR-218-5p, MIR218-1, miR-218, gga-miR-218, gga-miR-218-5p genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUGUGCUUGAUCUAACCAUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 41 other species

    1. Alligator mississippiensis (American alligator) ami-miR-218-5p
    2. Anolis carolinensis Aca-Mir-218-P4_5p (mature (guide))
    3. Ateles geoffroyi age-miR-218
    4. Bos taurus (cattle) Bta-Mir-218-P4_5p (mature (guide))
    5. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-218
    6. Canis lupus familiaris cfa-miR-218
    7. Capra hircus chi-miR-218
    8. Cavia porcellus (domestic guinea pig) Cpo-Mir-218-P4_5p (mature (guide))
    9. Cervus elaphus (red deer) cel-miR-218
    10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-218-P4_5p (mature (guide))
    11. Columba livia cli-miR-218-5p
    12. Dasypus novemcinctus Dno-Mir-218-P4_5p (mature (guide))
    13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-218-P4_5p (mature (guide))
    14. Equus caballus (horse) eca-miR-218
    15. Gekko japonicus Gja-Mir-218-P4_5p (mature (guide))
    16. Gorilla gorilla ggo-miR-218
    17. Homo sapiens (human) hsa-miR-218-5p
    18. Lagothrix lagotricha (brown woolly monkey) lla-miR-218
    19. Lemur catta (Ring-tailed lemur) lca-miR-218
    20. Macaca mulatta mml-miR-218-5p
    21. Macaca nemestrina (pig-tailed macaque) mne-miR-218
    22. Microcaecilia unicolor Mun-Mir-218-P2_5p (mature (guide))
    23. Monodelphis domestica (gray short-tailed opossum) mdo-miR-218-5p
    24. Mus musculus (house mouse) mmu-miR-218-5p
    25. Ornithorhynchus anatinus oan-miR-218-5p
    26. Oryctolagus cuniculus (rabbit) Ocu-Mir-218-P4_5p (mature (guide))
    27. Oryzias latipes (Japanese medaka) ola-miR-218a
    28. Ovis aries oar-miR-218a
    29. Pan paniscus (pygmy chimpanzee) ppa-miR-218
    30. Pan troglodytes (chimpanzee) ptr-miR-218
    31. Pongo pygmaeus ppy-miR-218
    32. Pteropus alecto pal-miR-218-5p
    33. Python bivittatus pbv-miR-218-5p
    34. Rattus norvegicus (Norway rat) rno-miR-218a-5p
    35. Saguinus labiatus (red-chested mustached tamarin) sla-miR-218
    36. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-218-P4_5p (mature (guide))
    37. Sphenodon punctatus Spt-Mir-218-P4_5p (mature (guide))
    38. Sus scrofa (pig) ssc-miR-218
    39. Taeniopygia guttata tgu-miR-218-5p
    40. Tupaia chinensis (Chinese tree shrew) tch-miR-218-5p
    41. Xenopus tropicalis xtr-miR-218
    Publications New