Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-218-5p URS000020D84A_10090

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Mus musculus. Annotated by 7 databases (LncBase, ENA, RefSeq, TarBase, MirGeneDB, miRBase, PirBase). Described in 27 papers. Mus musculus (house mouse) mmu-miR-218-5p sequence is a product of Mir218-2, mmu-miR-218-5p, miR-218-5p, mmu-miR-218, miR-218, Mir218-1 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007A15Rik, 0610008C09Rik, 0610009H04Rik, 0610009J05Rik, 0610011H20Rik, 0610011L13Rik, 0610011L14Rik, 0610011P08Rik, 0610020I02Rik, 0610025G21Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUGUGCUUGAUCUAACCAUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 72 other species

    1. Alligator mississippiensis ami-miR-218-5p
    2. Anolis carolinensis Aca-Mir-218-P1_5p (mature (guide))
    3. Ateles geoffroyi (black-handed spider monkey) age-miR-218
    4. Bos taurus (cattle) Bta-Mir-218-P2_5p (mature (guide))
    5. Callithrix jacchus cja-miR-218
    6. Canis lupus familiaris cfa-miR-218
    7. Capra hircus chi-miR-218
    8. Cavia porcellus (domestic guinea pig) Cpo-Mir-218-P2_5p (mature (guide))
    9. Cervus elaphus (red deer) cel-miR-218
    10. Chrysemys picta bellii Cpi-Mir-218-P1_5p (mature (guide))
    11. Columba livia (rock pigeon) cli-miR-218-5p
    12. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-218-P2_5p (mature (guide))
    13. Equus caballus (horse) eca-miR-218
    14. Gallus gallus (chicken) gga-miR-218-5p
    15. Gorilla gorilla (western gorilla) ggo-miR-218
    16. Homo sapiens hsa-miR-218-5p
    17. Lagothrix lagotricha lla-miR-218
    18. Lemur catta lca-miR-218
    19. Macaca mulatta mml-miR-218-5p
    20. Macaca nemestrina (pig-tailed macaque) mne-miR-218
    21. Monodelphis domestica mdo-miR-218-5p
    22. Ornithorhynchus anatinus oan-miR-218-5p
    23. Oryctolagus cuniculus (rabbit) Ocu-Mir-218-P2_5p (mature (guide))
    24. Oryzias latipes (Japanese medaka) ola-miR-218a
    25. Ovis aries oar-miR-218a
    26. Pan paniscus ppa-miR-218
    27. Pan troglodytes (chimpanzee) ptr-miR-218
    28. Pongo pygmaeus ppy-miR-218
    29. Pteropus alecto pal-miR-218-5p
    30. Python bivittatus pbv-miR-218-5p
    31. Rattus norvegicus rno-miR-218a-5p
    32. Saguinus labiatus sla-miR-218
    33. Sus scrofa ssc-miR-218-5p
    34. Taeniopygia guttata (zebra finch) tgu-miR-218-5p
    35. Tupaia chinensis tch-miR-218-5p
    36. Xenopus tropicalis xtr-miR-218