Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1478 SNR38 secondary structure diagram

Saccharomyces cerevisiae YJM1478 SNR38 URS000020D517_1294380

Automated summary: This snoRNA sequence is 95 nucleotides long and is found in Saccharomyces cerevisiae YJM1478. Annotated by 1 database (ENA). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snoR38, RF00213).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAUAAUGAUGAAAAAAAAUUUUAUCAAACAGUUAUCCCUGUCUGAAUGGGUAAUAAUAGGUAACCUCUCAUAUGUUGAUAUUUGUAUUUCUGAUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 91 other species

    1. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR38
    2. Saccharomyces cerevisiae EC1118 SNR38
    3. Saccharomyces cerevisiae Kyokai no. 7 K7_snR38
    4. Saccharomyces cerevisiae PE-2 SNR38
    5. Saccharomyces cerevisiae S288C Small Nucleolar RNA
    6. Saccharomyces cerevisiae YJM1078 SNR38
    7. Saccharomyces cerevisiae YJM1083 SNR38
    8. Saccharomyces cerevisiae YJM1129 SNR38
    9. Saccharomyces cerevisiae YJM1133 SNR38
    10. Saccharomyces cerevisiae YJM1190 SNR38
    11. Saccharomyces cerevisiae YJM1199 SNR38
    12. Saccharomyces cerevisiae YJM1202 SNR38
    13. Saccharomyces cerevisiae YJM1208 SNR38
    14. Saccharomyces cerevisiae YJM1242 SNR38
    15. Saccharomyces cerevisiae YJM1244 SNR38
    16. Saccharomyces cerevisiae YJM1250 SNR38
    17. Saccharomyces cerevisiae YJM1252 SNR38
    18. Saccharomyces cerevisiae YJM1273 SNR38
    19. Saccharomyces cerevisiae YJM1304 SNR38
    20. Saccharomyces cerevisiae YJM1307 SNR38
    21. Saccharomyces cerevisiae YJM1311 SNR38
    22. Saccharomyces cerevisiae YJM1326 SNR38
    23. Saccharomyces cerevisiae YJM1332 SNR38
    24. Saccharomyces cerevisiae YJM1336 SNR38
    25. Saccharomyces cerevisiae YJM1338 SNR38
    26. Saccharomyces cerevisiae YJM1341 SNR38
    27. Saccharomyces cerevisiae YJM1342 SNR38
    28. Saccharomyces cerevisiae YJM1355 SNR38
    29. Saccharomyces cerevisiae YJM1356 SNR38
    30. Saccharomyces cerevisiae YJM1381 SNR38
    31. Saccharomyces cerevisiae YJM1383 SNR38
    32. Saccharomyces cerevisiae YJM1385 SNR38
    33. Saccharomyces cerevisiae YJM1386 SNR38
    34. Saccharomyces cerevisiae YJM1387 SNR38
    35. Saccharomyces cerevisiae YJM1388 SNR38
    36. Saccharomyces cerevisiae YJM1389 SNR38
    37. Saccharomyces cerevisiae YJM1400 SNR38
    38. Saccharomyces cerevisiae YJM1401 SNR38
    39. Saccharomyces cerevisiae YJM1402 SNR38
    40. Saccharomyces cerevisiae YJM1415 SNR38
    41. Saccharomyces cerevisiae YJM1417 SNR38
    42. Saccharomyces cerevisiae YJM1418 SNR38
    43. Saccharomyces cerevisiae YJM1419 SNR38
    44. Saccharomyces cerevisiae YJM1433 SNR38
    45. Saccharomyces cerevisiae YJM1434 SNR38
    46. Saccharomyces cerevisiae YJM1443 SNR38
    47. Saccharomyces cerevisiae YJM1444 SNR38
    48. Saccharomyces cerevisiae YJM1447 SNR38
    49. Saccharomyces cerevisiae YJM1450 SNR38
    50. Saccharomyces cerevisiae YJM1460 SNR38
    51. Saccharomyces cerevisiae YJM1463 SNR38
    52. Saccharomyces cerevisiae YJM1477 SNR38
    53. Saccharomyces cerevisiae YJM1479 SNR38
    54. Saccharomyces cerevisiae YJM1526 SNR38
    55. Saccharomyces cerevisiae YJM1527 SNR38
    56. Saccharomyces cerevisiae YJM1549 SNR38
    57. Saccharomyces cerevisiae YJM1573 SNR38
    58. Saccharomyces cerevisiae YJM1574 SNR38
    59. Saccharomyces cerevisiae YJM1592 SNR38
    60. Saccharomyces cerevisiae YJM1615 SNR38
    61. Saccharomyces cerevisiae YJM189 SNR38
    62. Saccharomyces cerevisiae YJM193 SNR38
    63. Saccharomyces cerevisiae YJM244 SNR38
    64. Saccharomyces cerevisiae YJM248 SNR38
    65. Saccharomyces cerevisiae YJM270 SNR38
    66. Saccharomyces cerevisiae YJM271 SNR38
    67. Saccharomyces cerevisiae YJM320 SNR38
    68. Saccharomyces cerevisiae YJM326 SNR38
    69. Saccharomyces cerevisiae YJM428 SNR38
    70. Saccharomyces cerevisiae YJM450 SNR38
    71. Saccharomyces cerevisiae YJM451 SNR38
    72. Saccharomyces cerevisiae YJM453 SNR38
    73. Saccharomyces cerevisiae YJM456 SNR38
    74. Saccharomyces cerevisiae YJM470 SNR38
    75. Saccharomyces cerevisiae YJM541 SNR38
    76. Saccharomyces cerevisiae YJM554 SNR38
    77. Saccharomyces cerevisiae YJM555 SNR38
    78. Saccharomyces cerevisiae YJM682 SNR38
    79. Saccharomyces cerevisiae YJM683 SNR38
    80. Saccharomyces cerevisiae YJM689 SNR38
    81. Saccharomyces cerevisiae YJM693 SNR38
    82. Saccharomyces cerevisiae YJM969 SNR38
    83. Saccharomyces cerevisiae YJM972 SNR38
    84. Saccharomyces cerevisiae YJM975 SNR38
    85. Saccharomyces cerevisiae YJM978 SNR38
    86. Saccharomyces cerevisiae YJM981 SNR38
    87. Saccharomyces cerevisiae YJM984 SNR38
    88. Saccharomyces cerevisiae YJM987 SNR38
    89. Saccharomyces cerevisiae YJM990 SNR38
    90. Saccharomyces cerevisiae YJM993 SNR38
    91. Saccharomyces cerevisiae YJM996 SNR38
    2D structure New