v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long stress-induced non-coding transcript 5 (LSINCT5) URS000020D25D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LSINCT5: LSINCT5 is a long non-coding RNA (lncRNA) that has been studied in various cancer types, including osteosarcoma, endometrial cancer (EC), hepatocellular carcinoma (HCC), myocardial infarction (MI), ovarian cancer, gastric cancer (GC), and colorectal cancer (CRC) [PMC6500890] [PMC6769207] [PMC6276722] [PMC6089107] [PMC4626192] [PMC8568755] [PMC7812233] [PMC4603127]. In osteosarcoma, LSINCT5 expression levels were observed in tissues and cell lines, and loss-of-function and gain-of-function studies were conducted using G-292 and HOS cells, respectively [PMC6500890]. LSINCT5 knockdown did not influence HMGA1 transcripts in EC cells, suggesting a specific role for LSINCT5 in this context [PMC6769207]. LSINCT5 was found to interact with miR-4516 through luciferase activity and AGO2 RIP assay in EC cells [PMC6276722]. The core promoter region of LSINCT5 was examined for transcription factor-binding sites using online software programs, revealing four predicted tandem E2F1-binding sites that may regulate its expression levels in EC cells [PMC6089107]. In HCC cells, LSINCT5 was silenced to investigate its role in apoptosis. The greatest change in expression was observed when BNP-treated cells were used for silencing experiments. This suggests that LSINCT5 may promote HCC tumorigenesis by inhibiting apoptosis and inducing EMT processes. In MI patients, the upregulation of LSINCT5 was found to be associated with myocardial infarction. Additionally, high expression of LSINCT5 was correlated with advanced FIGO stage and lymph node metastasis in ovarian cancer patients. Furthermore, LSINCT5 expression was significantly higher in tumor tissues compared to adjacent normal tissues in GC and CRC [PMC8568755] [PMC7812233] [PMC4603127]. Overall, LSINCT5 appears to play a role in various cancer types and may have diagnostic and prognostic potential.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAACUUUUAUACGUUGUUGGAUUUUUAUUUUUUUCCUGUAUUUUAUUUGUUAUUUGAGCCAUAACAAAGAAUUUCACCACUCAAGUCAAAAACACAUUUUUUUCUAGUAAUUUGUGUUCUAGUACAAAUGUAGUCUCAUUCUAUUUAUCAUGCAGGUUGCUGAUGUCCUUGGGGUUUGUUCUGUUGUUUGGAGUGGGAUGUGACUUCAAUUGUAUGUUAUUGUUGCUUUUCCAAGUGGAUACUCGGUUCCGUUGAGGGCGUUUACCUUUGUUCUGGUCAUAUAUGAUCACCUUUAUUAUCUACUGAAGUCUGAUGUUCUCUGGGUCUAUUUCUGUCCUUUCUGGUUUAUUCCACUGGCCCAUUUGUCAAACCCUGCACCAGAACUACAGCACUUUAGUGGCAGAGAUUUUACAGCUGUUUUUUUUAUGCCUGGUGUCCUGGUGCUUCUCCUUCCUCUUUGCUCAUCUUUUUAAGGGAUUUCCUAGCUAUUGUUGCAUGACUGUUUUUCCAUGUAAACUUUAUUACCAAUGUAUAGCUAUAAAAAAUGCUUGCUGGGCCAGGCGCGAUGGCUCACACCUAUAAUCCCAGCACUUUGGGAGGCCGAGGCAGGUGGAUCACGAGGUCAGGAGAUGGAGACCAUCCUGGCUAACACGGUGGAACCCCGUCUCUACUAAAAAAAAUACAAAAAAUUAGCCGGGCGUGGUGGCGGGCGCCUGUAGUCCCAGCUACUCGGGAGGCUGAGGCAGGAGAAUGGUGUGAACCCAGGAGGCGGAGCUUGCAGUGAGCUGAGAUUGCACCACUGCCCUCCAGCCUGGGCUACAGAGCAAGGAAAAAAAAAUUCUUGCUGGCCUUAGAACUGGAUUAGUGUUAAAUUUGUCUGUUAGCUCUGCUAGAAUUUGACAACUUUAUGAUAGCAUGCUUCCUGCCGAAGAUCAAGAACUGCUUUUCAGCUGGUCAAGUCCACCUGGGAGCCUUUGGAAAGCAUUUGGAAGCUUUUCCCCUUAGGUUUUCCAUCGUUUAUCAAGAUCAUUCCUAAGAACUUUGUGGUUUUCACUGCUAUUUUAAACCGAGAUGUUUCUCUCUCCUUAUGUCUUCUAAGAGGUAAUGUGGAUAGGUAAAAAGGUGACUGAUUGUUGUGUGUUAGUUUUAUAUUCUCCUAAAUGUUUCUAAAGGCAAUUUUUCAUGAUUUAGACAACUUACUUAACCUCAUGAUCACGUUGAUCAAUACAGUCAGCACUGAAUCUUCUCCUCCCCUCCAAACACAUGGAUAAGGUGGAUAAGGAAUAUUUAAUUUUUUUUUUAAAAGCACAGCCGCCCAUGAAAGCAAGGAAGGAGAAUCUCUGUGGUACAGAAAUGGGGUUGGAGUCCCUGGGGUGAUCAGUGCUGUGGCCACAGGACCACUGUGGACCCAGAAGACCAGCAGCAGGGCCAACACCUGUCCAGGGUGGGAAACCCUACCUCAUCAUGGGGUGACAGCCUCAGGGGCUCCGGGGUGACUGGACUCUGACUGUGAACUGAGAAGGGGUUGAAACUGCUUUCCCUUCUCCCACACAGGCAGGGCUUCUGCUGAAAUGAGCUUCUGCCAGAAAUACCCCAGACACAUUCAAUACUGAAAUAUGGACCUGCAAAGUACCCAUAGGCAGGACCCCACCCUGGGCUAUUGCGGACUGGAGCCCCGAGCAGGAGAGCCCACCCAGGCUUGGCUUUGGAGCUGGAGGAGACAGCGGUGAAUGGAACUUCCGCUCAGGAUGGGGUCUGGAACACUGGGUUUGGGAACAACUAAGAGUCUCAUAAAGGGAAGACAUAGCAAGGCAGGUACAGAAAUAGCAAGGCGAUUGUUCAGGGGCAUUGAGCUAAGUAAGUAUAUAUUACAUUCUUAAGUAAAUACAUAAAAAUCAAAUGUGUAAAAAAAACAGAUGAAAGAGAAAUAGGCAUUUUUUAAAAUAGAAAUGUUGGAAAUGAUUAAUAUUAGUGAUGAAAUGAAUUCAAGCUCUUUCCCCCACGUAGCAGGCUGUGAGUUGGGUGAUCAGGCAGGGGUGGGAGACCCAUGGGGGAAGGGGCGGAAACAGAGCCAGUGGGGCUGGGCAUGGAGCUGAGUCCAAUAGCAUCAUAGGUCUGCUGUGGUACCCAACCGAUGCUCUGUCACCGGCAAGGGGUGUCUGGUCUUGAGGCUCUUGCCUGCUGAGUGGAAAGAUCUACGUCUUUCGGGAGACCUUGAUGGGACCUUGGCUUCAGAAAUGUCUCCCCCGCUCUCGGGGGAGCUGCUGCCCCAGCUGGGUCUUUGGUCUGACUGGGCUUUGAACACUCUCUCUGCCUGCUGCUCCUCUCUCUGCUCAGCCCUGCCUGGCGCAGAGAGCUGGGCACCUUCCACCCACCCCUGCUGGGAUGCAUCAAGCUGUCUCUCAGGAGGGCCCGGGCUCCUGGCUGCAGCUCUACCUGCCCAAGUCCCAAAAGUUCUCACACUGCAGGUGCUGCCUCAACCUCCACCCACUCAGCCUGCCAGCUACAAACCUCUGAACUGCAGGGUAGAAAAGGAGCUUGCCGAAGGUCCCUGCCUGCCUUGCCCCACAAUGUAGCCUCUCCCGGAAAGGCAAGCUCAGCCUCCACUGGAACCCACAUCUGACAUCUGUGUCCUAUAGUUGGCACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications