Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 42B (SNORD42B) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 42B (SNORD42B) URS000020C605_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD42B: SNORD42B is a small nucleolar RNA (snoRNA) that has been analyzed using the ΔΔCT method after normalization to human beta 2 microglobulin (B2M) [PMC5828204]. In a study conducted on primary splenocytes, the queuine modification status of SNORD42B was examined using the capture-release method followed by quantitative RT-PCR [PMC8136771]. SNORD42B was also subjected to validation in FFPE tissues of non-small cell lung cancer (NSCLC) patients, where its differential expression was identified [PMC9701848]. In addition to SNORD42B, other controls such as cel-miR-39-3p, SNORD69, SNORD61, SNORD68, SNORD96A, RNU6-2, miRTC, and PPC were included in the study [PMC4941693]. The expression of both SNORD42B and another snoRNA called SNORD111 in plasma remained stable and consistently measurable after treatment with Ribonuclease A (RNase A) or storage for 30 days [PMC9701848]. The levels of both snoRNAs were found to be significantly upregulated in NSCLC patients and were suggested as potential non-invasive diagnostic markers for NSCLC and early-stage NSCLC [PMC9701848]. Therefore, plasma levels of both SNORD42B and SNORD111 could serve as promising diagnostic biomarkers for NSCLC [PMC9701848].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCAUAUGAUGGAAAAGUUUUAAUCUCCUGACACUUGUGAUGUCUUCAAAGGAACCACUGAUGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications