Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-1946a URS000020C476_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-1946a: Mmu-mir-1946a is a type of microRNA that has been implicated in various diseases, including platelet disorder, familial, associated myeloid malignancy and leukemia, and acute myeloid [27-29]. It is one of the key miRNAs that may have a role in neurological disorders such as amyotrophic lateral sclerosis, attention-deficit hyperactivity disorder (ADHD), and bipolar disorder [30-34]. Dopamine, a neurotransmitter involved in signal transmission between nerve cells, interacts with dopamine receptors [PMC8874170]. Mmu-mir-1946a has been identified as one of the top significant miRNAs in various studies [PMC8874170]. It has been found to be upregulated in TC-1 cells and may be involved in the regulation of MMP-9 and TIMP-1 [PMC8986370]. Mmu-mir-1946a is predicted to bind to the 3' UTR of transforming growth factor (TGF-β1) in mouse lung fibroblasts, inhibiting its transcription [PMC8986370]. The expression of mmu-mir-1946a has been shown to be upregulated in BIPF (bleomycin-induced pulmonary fibrosis) and may play a regulatory role in this condition [PMC8986370]. Mmu-mir-1946a has also been found to interact with serpina3n, a potential target gene that is upregulated in BIPF [PMC8986370]. Additionally, mmu-mir-1946a has been shown to target several genes involved in fibrosis progression following BIPF [PMC8986370]. Further studies are needed to confirm the specific regulatory mechanisms of mmu-mir-1946a and its potential as a therapeutic target for diseases such as BIPF [PMC8986370][PMC9230989].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCCGGGCAGUGGUGGCACACACUUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications