Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-124-3p URS000020BE6A_9606

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Homo sapiens. Annotated by 6 databases (TarBase, GeneCards, MalaCards, ENA, IntAct, LncBase). Described in 42 papers. Homo sapiens (human) hsa-miR-124-3p sequence is a product of hsa-miR-124-3p, MIR124-2, MIR124-1, MIR124-3, miR-124-3p, miR-124, hsa-miR-124 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 1-8U, 1-Cys, 123F2, 133K02, 156DAG, 16.3A5, 16E1BP, 17-1A, 17b-HSD10.

Interactions 3

According to IntAct, Homo sapiens (human) hsa-miR-124-3p interacts with:

IntAct ID Participant Synonyms
EBI-20564397 URS000075DAEC_9606 EBI-20564368 URS000075DAEC_9606 lncrn_neat1 human short
EBI-25469894 intact:EBI-25469661 EBI-25469661 ENST00000264033 mrna_cbl-1
EBI-20564414 Q9UKV8 AGO2 Argonaute RISC catalytic component 2 EBI-528269 EIF2C2 Eukaryotic translation initiation factor 2C 2 PAZ Piwi domain protein Protein slicer Q8TCZ5 Q8WV58 Q96ID1 Q9UKV8 ago2_human

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAGGCACGCGGUGAAUGCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 12 other species

    1. Caenorhabditis remanei crm-miR-124a
    2. Capra hircus (goat) chi-miR-124a
    3. Equus caballus eca-miR-124
    4. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-124
    5. Ictalurus punctatus ipu-miR-124a
    6. Maylandia zebra mze-miR-124
    7. Mus musculus (house mouse) mmu-miR-124-3p
    8. Neolamprologus brichardi nbr-miR-124
    9. Oreochromis niloticus oni-miR-124a
    10. Polistes canadensis pca-miR-124-3p
    11. Pongo pygmaeus ppy-miR-124
    12. Pristionchus pacificus ppc-miR-124
    13. Rattus norvegicus (Norway rat) rno-miR-124-3p