Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-873 precursor URS0000209F04_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR873: MIR873 is a microRNA molecule that plays a role in various biological processes, including cancer development and drug resistance [PMC7589921]. It has been found to be upregulated in thyroid cancer, suggesting its involvement in the disease [PMC4621222]. Additionally, MIR873 has been identified as a potential biomarker for the diagnosis of different cancers, such as lung cancer and breast cancer [PMC4621222]. In the context of musculoskeletal disease, MIR873 has been associated with bone geometry and muscle metabolism [PMC3210160]. It is located within a genomic region that also contains the MIR876 gene, and both genes have been strongly associated with bone geometry and muscle mass in Chinese populations [PMC3210160]. However, these associations were not replicated in Caucasians [PMC3210160]. MIR873 has also been implicated in neural diseases based on its target genes associated with such diseases [PMC7708977]. In pregnancy-related conditions, circulating levels of MIR873 have been found to be negatively associated with insulin sensitivity [PMC8900031]. Overall, these findings highlight the diverse roles of MIR873 in various biological processes and its potential as a diagnostic biomarker for different diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGUGCAUUUGCAGGAACUUGUGAGUCUCCUAUUGAAAAUGAACAGGAGACUGAUGAGUUCCCGGGAACACCCACAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 50 other species

  1. Ailuropoda melanoleuca microRNA 873 (ENSAMEG00000023227.2)
  2. Aotus nancymaae microRNA 873 (ENSANAG00000011035.1)
  3. Callithrix jacchus microRNA mir-873
  4. Camelus dromedarius (Arabian camel) microRNA 873 (ENSCDRG00005002227.1)
  5. Camelus ferus microRNA mir-873
  6. Canis lupus familiaris microRNA mir-873
  7. Carlito syrichta (Philippine tarsier) microRNA 873 (ENSTSYG00000022750.2)
  8. Cebus imitator (Panamanian white-faced capuchin) microRNA 873 (ENSCCAG00000003708.1)
  9. Cercocebus atys (Sooty mangabey) microRNA 873 (ENSCATG00000017323.1)
  10. Chlorocebus sabaeus microRNA mir-873
  11. Choloepus hoffmanni (Hoffmann's two-fingered sloth) microRNA 873 (ENSCHOG00000014630.1)
  12. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000009456.1)
  13. Dasypus novemcinctus microRNA 873 (ENSDNOG00000038279.1)
  14. Dipodomys ordii (Ord's kangaroo rat) microRNA mir-873
  15. Equus asinus asinus (donkey) microRNA 873 (ENSEASG00005004616.1)
  16. Equus asinus microRNA 873 (ENSEASG00005004616.2)
  17. Equus caballus microRNA eca-mir-873 precursor
  18. Erinaceus europaeus microRNA 873 (ENSEEUG00000019422.1)
  19. Felis catus (domestic cat) microRNA mir-873
  20. Gorilla gorilla gorilla microRNA 873 (ENSGGOG00000033244.2)
  21. Gorilla gorilla microRNA mir-873
  22. Loxodonta africana microRNA 873 (ENSLAFG00000024724.1)
  23. Macaca mulatta (Rhesus monkey) microRNA mir-873
  24. Macaca nemestrina microRNA 873 (ENSMNEG00000037763.1)
  25. Mandrillus leucophaeus (Drill) microRNA 873 (ENSMLEG00000012559.1)
  26. Marmota marmota marmota microRNA 873 (ENSMMMG00000008948.1)
  27. Microcebus murinus (gray mouse lemur) microRNA 873 (ENSMICG00000028667.2)
  28. Mustela putorius furo microRNA 873 (ENSMPUG00000020587.1)
  29. Neogale vison microRNA 873 (ENSNVIG00000011717.1)
  30. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 873 (ENSNLEG00000022577.2)
  31. Ochotona princeps microRNA 873 (ENSOPRG00000017898.1)
  32. Oryctolagus cuniculus microRNA 873 (ENSOCUG00000020020.1)
  33. Pan paniscus microRNA 873 (ENSPPAG00000010125.1)
  34. Panthera pardus microRNA 873 (ENSPPRG00000013611.1)
  35. Panthera tigris altaica miRNA (ENSPTIG00000003237.1)
  36. Pan troglodytes (chimpanzee) ptr-mir-873 (ENSPTRG00000033643.2)
  37. Papio anubis microRNA mir-873
  38. Pongo abelii microRNA mir-873
  39. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-873 precursor
  40. Procavia capensis (cape rock hyrax) microRNA 873 (ENSPCAG00000019733.1)
  41. Propithecus coquereli microRNA 873 (ENSPCOG00000001572.1)
  42. Pteropus alecto (black flying fox) microRNA mir-873
  43. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 873 (ENSRFEG00010019008.1)
  44. Rhinopithecus bieti microRNA 873 (ENSRBIG00000005111.1)
  45. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 873 (ENSRROG00000006393.1)
  46. Saimiri boliviensis boliviensis microRNA 873 (ENSSBOG00000011738.1)
  47. Sciurus vulgaris microRNA 873 (ENSSVLG00005024274.1)
  48. Spermophilus dauricus miRNA (ENSSDAG00000001055.1, ENSSDAG00000016133.1)
  49. Ictidomys tridecemlineatus microRNA mir-873
  50. Urocitellus parryii (Arctic ground squirrel) microRNA 873 (ENSUPAG00010007964.1)
  51. Vicugna pacos microRNA 873 (ENSVPAG00000016896.1)
Publications