Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-125b-5p URS0000209905_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (MirGeneDB, RefSeq, ENA, LncBase, PSICQUIC, TarBase, MalaCards, GeneCards, miRBase). Described in 109 papers. Homo sapiens (human) hsa-miR-125b-5p sequence is a product of MIR125B1, miR-125b, miR-125b-5p, hsa-miR-125b-5p, MIR125B2, hsa-miR-125b, miR-125 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 14-3-3GAMMA, 14-3-3γ, 16.3A5, 2PP2A, 30K, 3D3, 4F2, 4F2HC, 4T2HC.

Interactions 17

According to PSICQUIC, Homo sapiens (human) hsa-miR-125b-5p interacts with:

Interaction id Participant Synonyms
URS0000209905_9606-0 P01375 P01375
URS0000209905_9606-9 P01375 P01375
URS0000209905_9606-10 P07332 P07332
URS0000209905_9606-1 P07332 P07332
URS0000209905_9606-2 P08887 P08887
URS0000209905_9606-11 P08887 P08887
URS0000209905_9606-3 P09603 P09603
URS0000209905_9606-12 P09603 P09603
URS0000209905_9606-13 P11473 P11473
URS0000209905_9606-4 P11473 P11473
URS0000209905_9606-7 P21802 P21802
URS0000209905_9606-14 P21802 P21802
URS0000209905_9606-15 P33151 P33151
URS0000209905_9606-8 P33151 P33151
URS0000209905_9606-5 P42771 P42771
URS0000209905_9606-6 P78423 P78423
URS0000209905_9606-16 P78423 P78423

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCCUGAGACCCUAACUUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 176 other species

    1. Aedes aegypti aae-miR-125-5p
    2. Alligator mississippiensis ami-miR-125b-5p
    3. Anolis carolinensis aca-miR-125b
    4. Anopheles gambiae aga-miR-125
    5. Ateles geoffroyi (black-handed spider monkey) age-miR-125b
    6. Bactrocera dorsalis (oriental fruit fly) bdo-miR-125
    7. Blattella germanica Bge-Mir-10-P3_5p (mature (guide))
    8. Bos taurus (cattle) bta-miR-125b
    9. Branchiostoma belcheri bbe-miR-125a-5p
    10. Branchiostoma floridae bfl-miR-125a-5p
    11. Callithrix jacchus cja-miR-125b
    12. Callorhinchus milii (elephant shark) eshark_mir-125_2
    13. Canis lupus familiaris cfa-miR-125b
    14. Capitella teleta cte-miR-125
    15. Capra hircus miR-125b
    16. Cavia porcellus (domestic guinea pig) cpo-miR-125b-5p
    17. Cervus elaphus (red deer) cel-miR-125b
    18. Chrysemys picta bellii Cpi-Mir-10-P3a_5p (mature (guide))
    19. Chrysemys picta (Painted turtle) cpi-miR-125b-5p
    20. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-125
    21. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-125
    22. Columba livia (rock pigeon) cli-miR-125-5p
    23. Cricetulus griseus cgr-miR-125b-5p
    24. Culex quinquefasciatus cqu-miR-125-5p
    25. Cyprinus carpio ccr-miR-125b
    26. Danio rerio (zebrafish) dre-miR-125b-5p
    27. Daphnia pulex Dpu-Mir-10-P3_5p (mature (guide))
    28. Dasypus novemcinctus (nine-banded armadillo) dno-miR-125b-5p
    29. Daubentonia madagascariensis (aye-aye) dma-miR-125b
    30. Dinoponera quadriceps dqu-miR-125-5p
    31. Drosophila ananassae dan-miR-125
    32. Drosophila erecta der-miR-125
    33. Drosophila grimshawi dgr-miR-125
    34. Drosophila melanogaster (fruit fly) dme-miR-125-5p
    35. Drosophila mojavensis dmo-miR-125
    36. Drosophila persimilis dpe-miR-125
    37. Drosophila pseudoobscura dps-miR-125
    38. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294457_df_nrg
    39. Drosophila sechellia dse-miR-125
    40. Drosophila simulans dsi-miR-125
    41. Drosophila willistoni dwi-miR-125
    42. Drosophila yakuba dya-miR-125
    43. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-10-P3c_5p (mature (guide))
    44. Equus caballus (horse) eca-miR-125b-5p
    45. Gadus morhua gmo-miR-125b-5p
    46. Gallus gallus (chicken) gga-miR-125b-5p
    47. Gorilla gorilla (western gorilla) ggo-miR-125b
    48. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-125b
    49. Ictalurus punctatus (channel catfish) ipu-miR-125b
    50. Ixodes ricinus iri-miR-125b-5p
    51. Ixodes scapularis (black-legged tick) Isc-Mir-10-P3_5p (mature (guide))
    52. Lagothrix lagotricha lla-miR-125b
    53. Lemur catta lca-miR-125b
    54. Lytechinus variegatus (green sea urchin) lva-miR-125-5p
    55. Macaca mulatta mml-miR-125b-5p
    56. Macaca nemestrina (pig-tailed macaque) mne-miR-125b
    57. Maylandia zebra mze-miR-125b
    58. Microcebus murinus mmr-miR-125a
    59. Monodelphis domestica mdo-miR-125b-5p
    60. Mus musculus (house mouse) mmu-miR-125b-5p
    61. Nasonia longicornis nlo-miR-125
    62. Nasonia vitripennis nvi-miR-125
    63. Neolamprologus brichardi nbr-miR-125b
    64. Nomascus leucogenys nle-miR-125b
    65. Oreochromis niloticus oni-miR-125b
    66. Ornithorhynchus anatinus oan-miR-125-5p
    67. Oryctolagus cuniculus (rabbit) ocu-miR-125b-5p
    68. Oryzias latipes (Japanese medaka) ola-miR-125b
    69. Otolemur garnettii oga-miR-125b
    70. Ovis aries microRNA miR-125b
    71. Pan paniscus ppa-miR-125b
    72. Pan troglodytes (chimpanzee) ptr-miR-125b
    73. Papio hamadryas (hamadryas baboon) pha-miR-125b
    74. Patiria miniata pmi-miR-125-5p
    75. Petromyzon marinus pma-miR-125-5p
    76. Pongo pygmaeus ppy-miR-125b
    77. Pteropus alecto pal-miR-125b-5p
    78. Ptychodera flava Pfl-Mir-10-P3_5p (mature (guide))
    79. Pundamilia nyererei pny-miR-125b
    80. Python bivittatus pbv-miR-125b-5p
    81. Rattus norvegicus rno-miR-125b-5p
    82. Saccoglossus kowalevskii sko-miR-125a
    83. Saguinus labiatus sla-miR-125b
    84. Salmo salar (Atlantic salmon) ssa-miR-125a-5p
    85. Sarcophilus harrisii sha-miR-125a
    86. Scyliorhinus torazame (cloudy catshark) Sto-Mir-10-P3c_5p (mature (guide))
    87. Strongylocentrotus purpuratus spu-miR-125-5p
    88. Sus scrofa ssc-miR-125b
    89. Taeniopygia guttata (zebra finch) tgu-miR-125-5p
    90. Takifugu rubripes (torafugu) fru-miR-125b
    91. Tetraodon nigroviridis tni-miR-125b
    92. Tor tambroides miR-125b-5p
    93. Tribolium castaneum (red flour beetle) tca-miR-125-5p
    94. Triops cancriformis tcf-miR-125
    95. Tupaia chinensis tch-miR-125b-5p
    96. Xenopus laevis (African clawed frog) xla-miR-125b-5p
    97. Xenopus tropicalis xtr-miR-125b