Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-125b-5p URS0000209905_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-125b: Gga-mir-125b is a specific type of microRNA that has been studied in relation to tumorigenesis and viral infections. Real-time PCR was used to analyze the expression of gga-mir-125b in ALV-J-infected chickens, and it was found to be differentially expressed [PMC6723722]. In addition, gga-mir-125b was shown to be associated with tumorigenesis-related pathways and ALV-J-induced tumorigenesis [PMC5065965]. Several other miRNAs, including gga-mir-125b, have also been reported to be associated with tumorigenesis and viral infections [PMC5276853]. Furthermore, gga-mir-125b displayed opposing expression patterns in infected liver tissues and dendritic cells [PMC7587795]. In the context of H5N1-infected chickens, gga-mir-125b was found to be down-regulated [PMC7931527]. The expression of gga-mir-125b has also been studied in relation to the MAPK signaling pathway and the Wnt signaling pathway in hepatic tumor tissues of chickens infected with ALV-J [PMC6862082]. Additionally, qRT-PCR analysis confirmed the differential expression of gga-miR-221, gga-miR-211, gga-miR-222a, gga-miR-193b, and gga-mir-125b in infected cells compared with mock-infected cells [PMC4735322]. Overall, these studies highlight the importance of understanding the role of miRNAs like gga-mir-125b in tumorigenesis and viral infections.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCUGAGACCCUAACUUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 109 other species

  1. Aedes aegypti (yellow fever mosquito) aae-miR-125-5p
  2. Alligator mississippiensis ami-miR-125b-5p
  3. Anolis carolinensis aca-miR-125b
  4. Anopheles gambiae aga-miR-125
  5. Ateles geoffroyi (black-handed spider monkey) age-miR-125b
  6. Bactrocera dorsalis bdo-miR-125
  7. Blattella germanica Bge-Mir-10-P3_5p (mature (guide))
  8. Bos taurus (cattle) bta-miR-125b
  9. Brachionus plicatilis Bpl-Mir-10-P3_5p (mature (guide))
  10. Branchiostoma belcheri bbe-miR-125a-5p
  11. Branchiostoma floridae bfl-miR-125a-5p
  12. Branchiostoma lanceolatum (amphioxus) Bla-Mir-10-P3_5p (mature (guide))
  13. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-125b
  14. Callorhinchus milii (elephant shark) Cmi-Mir-10-P3d_5p (mature (guide))
  15. Canis lupus familiaris (dog) cfa-miR-125b
  16. Capitella teleta cte-miR-125
  17. Capra hircus miR-125b
  18. Cavia porcellus cpo-miR-125b-5p
  19. Centruroides sculpturatus Csc-Mir-10-P3r2_5p (mature (guide))
  20. Cervus elaphus (red deer) cel-miR-125b
  21. Chrysemys picta bellii (western painted turtle) Cpi-Mir-10-P3d_5p (mature (guide))
  22. Chrysemys picta (Painted turtle) cpi-miR-125b-5p
  23. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-125
  24. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-125
  25. Columba livia cli-miR-125-5p
  26. Cricetulus griseus (Chinese hamster) cgr-miR-125b-5p
  27. Culex quinquefasciatus cqu-miR-125-5p
  28. Cyprinus carpio (common carp) ccr-miR-125b
  29. Danio rerio dre-miR-125b-5p
  30. Daphnia magna Dma-Mir-10-P3_5p (mature (guide))
  31. Daphnia pulex (common water flea) Dpu-Mir-10-P3_5p (mature (guide))
  32. Dasypus novemcinctus dno-miR-125b-5p
  33. Daubentonia madagascariensis (aye-aye) dma-miR-125b
  34. Dinoponera quadriceps dqu-miR-125-5p
  35. Drosophila ananassae dan-miR-125
  36. Drosophila erecta der-miR-125
  37. Drosophila grimshawi dgr-miR-125
  38. Drosophila melanogaster (fruit fly) dme-miR-125-5p
  39. Drosophila mojavensis dmo-miR-125
  40. Drosophila persimilis dpe-miR-125
  41. Drosophila pseudoobscura dps-miR-125
  42. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294457_df_nrg
  43. Drosophila sechellia dse-miR-125
  44. Drosophila simulans dsi-miR-125
  45. Drosophila willistoni dwi-miR-125
  46. Drosophila yakuba dya-miR-125
  47. Echinops telfairi Ete-Mir-10-P3c_5p (mature (guide))
  48. Eptatretus burgeri (inshore hagfish) Ebu-Mir-10-P3e_5p (mature (guide))
  49. Equus caballus (horse) eca-miR-125b-5p
  50. Gadus morhua gmo-miR-125b-5p
  51. Gekko japonicus Gja-Mir-10-P3c_5p (mature (guide))
  52. Gorilla gorilla gorilla ggo-miR-125b (MIR125B-1)
  53. Gorilla gorilla (western gorilla) ggo-miR-125b
  54. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-125b
  55. Homo sapiens hsa-miR-125b-5p
  56. Ictalurus punctatus (channel catfish) ipu-miR-125b
  57. Ixodes ricinus (castor bean tick) iri-miR-125b-5p
  58. Ixodes scapularis Isc-Mir-10-P3_5p (mature (guide))
  59. Lagothrix lagotricha (brown woolly monkey) lla-miR-125b
  60. Latimeria chalumnae Lch-Mir-10-P3d_5p (mature (guide))
  61. Lemur catta (Ring-tailed lemur) lca-miR-125b
  62. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P3c_5p (mature (guide))
  63. Lytechinus variegatus lva-miR-125-5p
  64. Macaca mulatta (Rhesus monkey) mml-miR-125b-5p
  65. Macaca nemestrina mne-miR-125b
  66. Maylandia zebra (zebra mbuna) mze-miR-125b
  67. Microcaecilia unicolor Mun-Mir-10-P3d_5p (mature (guide))
  68. Microcebus murinus (gray mouse lemur) mmr-miR-125a
  69. Monodelphis domestica (gray short-tailed opossum) mdo-miR-125b-5p
  70. Monopterus albus (swamp eel) Mal-Mir-10-P3c2_5p (mature (guide))
  71. Mus musculus (house mouse) mmu-miR-125b-5p
  72. Nasonia longicornis nlo-miR-125
  73. Nasonia vitripennis nvi-miR-125
  74. Neolamprologus brichardi (lyretail cichlid) nbr-miR-125b
  75. Nomascus leucogenys nle-miR-125b
  76. Oreochromis niloticus oni-miR-125b
  77. Ornithorhynchus anatinus (platypus) oan-miR-125-5p
  78. Oryctolagus cuniculus ocu-miR-125b-5p
  79. Oryzias latipes ola-miR-125b
  80. Otolemur garnettii oga-miR-125b
  81. Ovis aries (sheep) microRNA miR-125b
  82. Pan paniscus ppa-miR-125b
  83. Pan troglodytes (chimpanzee) ptr-miR-125b
  84. Papio hamadryas (hamadryas baboon) pha-miR-125b
  85. Patiria miniata (sea bat) pmi-miR-125-5p
  86. Petromyzon marinus pma-miR-125-5p
  87. Pongo pygmaeus (Bornean orangutan) ppy-miR-125b
  88. Pteropus alecto pal-miR-125b-5p
  89. Ptychodera flava Pfl-Mir-10-P3j2_5p (mature (guide))
  90. Pundamilia nyererei pny-miR-125b
  91. Python bivittatus pbv-miR-125b-5p
  92. Rattus norvegicus rno-miR-125b-5p
  93. Saccoglossus kowalevskii sko-miR-125a
  94. Saguinus labiatus (red-chested mustached tamarin) sla-miR-125b
  95. Salmo salar (Atlantic salmon) ssa-miR-125a-5p
  96. Sarcophilus harrisii sha-miR-125a
  97. Scyliorhinus torazame Sto-Mir-10-P3d_5p (mature (guide))
  98. Sphenodon punctatus (tuatara) Spt-Mir-10-P3c_5p (mature (guide))
  99. Strongylocentrotus purpuratus (purple sea urchin) spu-miR-125-5p
  100. Sus scrofa (pig) ssc-miR-125b
  101. Taeniopygia guttata (zebra finch) tgu-miR-125-5p
  102. Takifugu rubripes (torafugu) fru-miR-125b
  103. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-125b
  104. Tor tambroides miR-125b-5p
  105. Tribolium castaneum (red flour beetle) tca-miR-125-5p
  106. Triops cancriformis tcf-miR-125
  107. Tupaia chinensis (Chinese tree shrew) tch-miR-125b-5p
  108. Xenopus laevis (African clawed frog) xla-miR-125b-5p
  109. Xenopus tropicalis (tropical clawed frog) xtr-miR-125b
Publications