Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-125b-5p URS0000209905_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (ENA, miRBase, RefSeq, MirGeneDB). Described in 20 papers. Danio rerio (zebrafish) dre-miR-125b-5p sequence is a product of miR-125b, miR-125b-5p, dre-miR-125b-5p, mir125b-2, mir125b-1, mir125b-3, dre-miR-125b, miR-125 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCCUGAGACCCUAACUUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 762 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-125-5p
    2. Alligator mississippiensis ami-miR-125b-5p
    3. Anolis carolinensis (green anole) aca-miR-125b
    4. Anopheles gambiae (African malaria mosquito) aga-miR-125
    5. Ateles geoffroyi age-miR-125b
    6. Bactrocera dorsalis (oriental fruit fly) bdo-miR-125
    7. Blattella germanica (German cockroach) Bge-Mir-10-P3_5p (mature (guide))
    8. Bos taurus bta-miR-125b
    9. Brachionus plicatilis Bpl-Mir-10-P3_5p (mature (guide))
    10. Branchiostoma belcheri bbe-miR-125a-5p
    11. Branchiostoma floridae (Florida lancelet) bfl-miR-125a-5p
    12. Branchiostoma lanceolatum (amphioxus) Bla-Mir-10-P3_5p (mature (guide))
    13. Callithrix jacchus cja-miR-125b
    14. Callorhinchus milii Cmi-Mir-10-P3d_5p (mature (guide))
    15. Canis lupus familiaris cfa-miR-125b
    16. Capitella teleta cte-miR-125
    17. Capra hircus (goat) miR-125b
    18. Cavia porcellus cpo-miR-125b-5p
    19. Centruroides sculpturatus (bark scorpion) Csc-Mir-10-P3r2_5p (mature (guide))
    20. Cervus elaphus (red deer) cel-miR-125b
    21. Chrysemys picta bellii (western painted turtle) Cpi-Mir-10-P3d_5p (mature (guide))
    22. Chrysemys picta (Painted turtle) cpi-miR-125b-5p
    23. Cochliomyia hominivorax mature cho-miR-125
    24. Cochliomyia macellaria mature cma-miR-125
    25. Columba livia (rock pigeon) cli-miR-125-5p
    26. Cricetulus griseus cgr-miR-125b-5p
    27. Culex quinquefasciatus (southern house mosquito) cqu-miR-125-5p
    28. Cyprinus carpio (common carp) ccr-miR-125b
    29. Daphnia magna Dma-Mir-10-P3_5p (mature (guide))
    30. Daphnia pulex (common water flea) Dpu-Mir-10-P3_5p (mature (guide))
    31. Dasypus novemcinctus dno-miR-125b-5p
    32. Daubentonia madagascariensis dma-miR-125b
    33. Dinoponera quadriceps dqu-miR-125-5p
    34. Drosophila ananassae dan-miR-125
    35. Drosophila erecta der-miR-125
    36. Drosophila grimshawi dgr-miR-125
    37. Drosophila melanogaster dme-miR-125-5p
    38. Drosophila mojavensis dmo-miR-125
    39. Drosophila persimilis dpe-miR-125
    40. Drosophila pseudoobscura dps-miR-125
    41. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294457_df_nrg
    42. Drosophila sechellia dse-miR-125
    43. Drosophila simulans dsi-miR-125
    44. Drosophila willistoni dwi-miR-125
    45. Drosophila yakuba dya-miR-125
    46. Echinops telfairi Ete-Mir-10-P3c_5p (mature (guide))
    47. Eptatretus burgeri (inshore hagfish) Ebu-Mir-10-P3e_5p (mature (guide))
    48. Equus caballus (horse) eca-miR-125b-5p
    49. Gadus morhua gmo-miR-125b-5p
    50. Gallus gallus (chicken) gga-miR-125b-5p
    51. Gekko japonicus Gja-Mir-10-P3c_5p (mature (guide))
    52. Gorilla gorilla ggo-miR-125b
    53. Haplochromis burtoni abu-miR-125b
    54. Homo sapiens hsa-miR-125b-5p
    55. Ictalurus punctatus ipu-miR-125b
    56. Ixodes ricinus (castor bean tick) iri-miR-125b-5p
    57. Ixodes scapularis (black-legged tick) Isc-Mir-10-P3_5p (mature (guide))
    58. Lagothrix lagotricha (brown woolly monkey) lla-miR-125b
    59. Latimeria chalumnae Lch-Mir-10-P3d_5p (mature (guide))
    60. Lemur catta lca-miR-125b
    61. Lepisosteus oculatus Loc-Mir-10-P3c_5p (mature (guide))
    62. Lytechinus variegatus (green sea urchin) lva-miR-125-5p
    63. Macaca mulatta (Rhesus monkey) mml-miR-125b-5p
    64. Macaca nemestrina (pig-tailed macaque) mne-miR-125b
    65. Maylandia zebra (zebra mbuna) mze-miR-125b
    66. Microcaecilia unicolor Mun-Mir-10-P3d_5p (mature (guide))
    67. Microcebus murinus (gray mouse lemur) mmr-miR-125a
    68. Monodelphis domestica mdo-miR-125b-5p
    69. Monopterus albus (swamp eel) Mal-Mir-10-P3c2_5p (mature (guide))
    70. Mus musculus mmu-miR-125b-5p
    71. Nasonia longicornis nlo-miR-125
    72. Nasonia vitripennis nvi-miR-125
    73. Neolamprologus brichardi nbr-miR-125b
    74. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-125b
    75. Oreochromis niloticus oni-miR-125b
    76. Ornithorhynchus anatinus oan-miR-125-5p
    77. Oryctolagus cuniculus ocu-miR-125b-5p
    78. Oryzias latipes (Japanese medaka) ola-miR-125b
    79. Otolemur garnettii oga-miR-125b
    80. Ovis aries microRNA miR-125b
    81. Pan paniscus ppa-miR-125b
    82. Pan troglodytes ptr-miR-125b
    83. Papio hamadryas pha-miR-125b
    84. Patiria miniata pmi-miR-125-5p
    85. Petromyzon marinus (sea lamprey) pma-miR-125-5p
    86. Pongo pygmaeus (Bornean orangutan) ppy-miR-125b
    87. Pteropus alecto (black flying fox) pal-miR-125b-5p
    88. Ptychodera flava Pfl-Mir-10-P3j2_5p (mature (guide))
    89. Pundamilia nyererei pny-miR-125b
    90. Python bivittatus (Burmese python) pbv-miR-125b-5p
    91. Rattus norvegicus rno-miR-125b-5p
    92. Saccoglossus kowalevskii sko-miR-125a
    93. Saguinus labiatus sla-miR-125b
    94. Salmo salar ssa-miR-125a-5p
    95. Sarcophilus harrisii sha-miR-125a
    96. Scyliorhinus torazame Sto-Mir-10-P3d_5p (mature (guide))
    97. Sphenodon punctatus Spt-Mir-10-P3c_5p (mature (guide))
    98. Strongylocentrotus purpuratus spu-miR-125-5p
    99. Sus scrofa (pig) ssc-miR-125b
    100. Taeniopygia guttata tgu-miR-125-5p
    101. Takifugu rubripes fru-miR-125b
    102. Tetraodon nigroviridis tni-miR-125b
    103. Tor tambroides miR-125b-5p
    104. Tribolium castaneum (red flour beetle) tca-miR-125-5p
    105. Triops cancriformis tcf-miR-125
    106. Tupaia chinensis tch-miR-125b-5p
    107. Xenopus laevis (African clawed frog) xla-miR-125b-5p
    108. Xenopus tropicalis (tropical clawed frog) xtr-miR-125b
    Publications New