Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aedes aegypti (yellow fever mosquito) aae-miR-125-5p URS0000209905_7159

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

aae-mir-125: Aae-mir-125 is a microRNA that has been found to be significantly upregulated in CHIKV-infected Ae. [PMC7690852]. It is one of several microRNAs that are highly expressed in both uninfected and infected Ae. [PMC5951587]. Aae-mir-125 is also highly expressed in the saliva of CHIKV-infected Ae.albopictus, with a read count of 4333 [PMC4303268]. MicroRNA inhibitors have been designed based on the sequence of aae-mir-125, along with other select microRNAs, to study their effects [PMC4303268]. In CHIKV-infected Ae.aegypti saliva, aae-mir-125 is also highly expressed with a read count of 15735 [PMC4303268]. Aae-mir-125 and aae-mir-100 are suggested to play a role in regulating immune cell activity at the bite site and influencing CHIKV replication [PMC4303268]. In comparison to uninfected saliva, aae-mir-2940 is downregulated while aae-mir-125, along with other microRNAs such as aae-mir-263a and aae-mir-100, are upregulated in CHIKV-infected Ae.albopictus saliva [PMC4303268]. Similarly, in CHIKV-infected Ae.aegypti saliva, highly expressed microRNAs include not only aae-mir-125 but also other microRNAs such as aae-miR-bantam and 263a [PMC4303268]. These findings suggest that these highly expressed microRNAs may play important roles in the response to CHIKV infection.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCUGAGACCCUAACUUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 109 other species

  1. Alligator mississippiensis ami-miR-125b-5p
  2. Anolis carolinensis aca-miR-125b
  3. Anopheles gambiae aga-miR-125
  4. Ateles geoffroyi (black-handed spider monkey) age-miR-125b
  5. Bactrocera dorsalis bdo-miR-125
  6. Blattella germanica Bge-Mir-10-P3_5p (mature (guide))
  7. Bos taurus (cattle) bta-miR-125b
  8. Brachionus plicatilis Bpl-Mir-10-P3_5p (mature (guide))
  9. Branchiostoma belcheri bbe-miR-125a-5p
  10. Branchiostoma floridae bfl-miR-125a-5p
  11. Branchiostoma lanceolatum (amphioxus) Bla-Mir-10-P3_5p (mature (guide))
  12. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-125b
  13. Callorhinchus milii (elephant shark) Cmi-Mir-10-P3d_5p (mature (guide))
  14. Canis lupus familiaris (dog) cfa-miR-125b
  15. Capitella teleta cte-miR-125
  16. Capra hircus miR-125b
  17. Cavia porcellus cpo-miR-125b-5p
  18. Centruroides sculpturatus Csc-Mir-10-P3r2_5p (mature (guide))
  19. Cervus elaphus (red deer) cel-miR-125b
  20. Chrysemys picta bellii (western painted turtle) Cpi-Mir-10-P3d_5p (mature (guide))
  21. Chrysemys picta (Painted turtle) cpi-miR-125b-5p
  22. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-125
  23. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-125
  24. Columba livia cli-miR-125-5p
  25. Cricetulus griseus (Chinese hamster) cgr-miR-125b-5p
  26. Culex quinquefasciatus cqu-miR-125-5p
  27. Cyprinus carpio (common carp) ccr-miR-125b
  28. Danio rerio dre-miR-125b-5p
  29. Daphnia magna Dma-Mir-10-P3_5p (mature (guide))
  30. Daphnia pulex (common water flea) Dpu-Mir-10-P3_5p (mature (guide))
  31. Dasypus novemcinctus dno-miR-125b-5p
  32. Daubentonia madagascariensis (aye-aye) dma-miR-125b
  33. Dinoponera quadriceps dqu-miR-125-5p
  34. Drosophila ananassae dan-miR-125
  35. Drosophila erecta der-miR-125
  36. Drosophila grimshawi dgr-miR-125
  37. Drosophila melanogaster (fruit fly) dme-miR-125-5p
  38. Drosophila mojavensis dmo-miR-125
  39. Drosophila persimilis dpe-miR-125
  40. Drosophila pseudoobscura dps-miR-125
  41. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294457_df_nrg
  42. Drosophila sechellia dse-miR-125
  43. Drosophila simulans dsi-miR-125
  44. Drosophila willistoni dwi-miR-125
  45. Drosophila yakuba dya-miR-125
  46. Echinops telfairi Ete-Mir-10-P3c_5p (mature (guide))
  47. Eptatretus burgeri (inshore hagfish) Ebu-Mir-10-P3e_5p (mature (guide))
  48. Equus caballus (horse) eca-miR-125b-5p
  49. Gadus morhua gmo-miR-125b-5p
  50. Gallus gallus gga-miR-125b-5p
  51. Gekko japonicus Gja-Mir-10-P3c_5p (mature (guide))
  52. Gorilla gorilla gorilla ggo-miR-125b (MIR125B-1)
  53. Gorilla gorilla (western gorilla) ggo-miR-125b
  54. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-125b
  55. Homo sapiens hsa-miR-125b-5p
  56. Ictalurus punctatus (channel catfish) ipu-miR-125b
  57. Ixodes ricinus (castor bean tick) iri-miR-125b-5p
  58. Ixodes scapularis Isc-Mir-10-P3_5p (mature (guide))
  59. Lagothrix lagotricha (brown woolly monkey) lla-miR-125b
  60. Latimeria chalumnae Lch-Mir-10-P3d_5p (mature (guide))
  61. Lemur catta (Ring-tailed lemur) lca-miR-125b
  62. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P3c_5p (mature (guide))
  63. Lytechinus variegatus lva-miR-125-5p
  64. Macaca mulatta (Rhesus monkey) mml-miR-125b-5p
  65. Macaca nemestrina mne-miR-125b
  66. Maylandia zebra (zebra mbuna) mze-miR-125b
  67. Microcaecilia unicolor Mun-Mir-10-P3d_5p (mature (guide))
  68. Microcebus murinus (gray mouse lemur) mmr-miR-125a
  69. Monodelphis domestica (gray short-tailed opossum) mdo-miR-125b-5p
  70. Monopterus albus (swamp eel) Mal-Mir-10-P3c2_5p (mature (guide))
  71. Mus musculus (house mouse) mmu-miR-125b-5p
  72. Nasonia longicornis nlo-miR-125
  73. Nasonia vitripennis nvi-miR-125
  74. Neolamprologus brichardi (lyretail cichlid) nbr-miR-125b
  75. Nomascus leucogenys nle-miR-125b
  76. Oreochromis niloticus oni-miR-125b
  77. Ornithorhynchus anatinus (platypus) oan-miR-125-5p
  78. Oryctolagus cuniculus ocu-miR-125b-5p
  79. Oryzias latipes ola-miR-125b
  80. Otolemur garnettii oga-miR-125b
  81. Ovis aries (sheep) microRNA miR-125b
  82. Pan paniscus ppa-miR-125b
  83. Pan troglodytes (chimpanzee) ptr-miR-125b
  84. Papio hamadryas (hamadryas baboon) pha-miR-125b
  85. Patiria miniata (sea bat) pmi-miR-125-5p
  86. Petromyzon marinus pma-miR-125-5p
  87. Pongo pygmaeus (Bornean orangutan) ppy-miR-125b
  88. Pteropus alecto pal-miR-125b-5p
  89. Ptychodera flava Pfl-Mir-10-P3j2_5p (mature (guide))
  90. Pundamilia nyererei pny-miR-125b
  91. Python bivittatus pbv-miR-125b-5p
  92. Rattus norvegicus rno-miR-125b-5p
  93. Saccoglossus kowalevskii sko-miR-125a
  94. Saguinus labiatus (red-chested mustached tamarin) sla-miR-125b
  95. Salmo salar (Atlantic salmon) ssa-miR-125a-5p
  96. Sarcophilus harrisii sha-miR-125a
  97. Scyliorhinus torazame Sto-Mir-10-P3d_5p (mature (guide))
  98. Sphenodon punctatus (tuatara) Spt-Mir-10-P3c_5p (mature (guide))
  99. Strongylocentrotus purpuratus (purple sea urchin) spu-miR-125-5p
  100. Sus scrofa (pig) ssc-miR-125b
  101. Taeniopygia guttata (zebra finch) tgu-miR-125-5p
  102. Takifugu rubripes (torafugu) fru-miR-125b
  103. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-125b
  104. Tor tambroides miR-125b-5p
  105. Tribolium castaneum (red flour beetle) tca-miR-125-5p
  106. Triops cancriformis tcf-miR-125
  107. Tupaia chinensis (Chinese tree shrew) tch-miR-125b-5p
  108. Xenopus laevis (African clawed frog) xla-miR-125b-5p
  109. Xenopus tropicalis (tropical clawed frog) xtr-miR-125b
Publications