Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-125b-5p URS0000209905_13616

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Monodelphis domestica. Annotated by 4 databases (ENA, MirGeneDB, RefSeq, miRBase). Monodelphis domestica (gray short-tailed opossum) mdo-miR-125b-5p sequence is a product of miR-125b, miR-125, mdo-miR-125b-5p, MIR125B-2, miR-125b-5p, mdo-miR-125b, MIR125B-1 genes. Found in the gray short-tailed opossum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCCCUGAGACCCUAACUUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 108 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-125-5p
    2. Alligator mississippiensis (American alligator) ami-miR-125b-5p
    3. Anolis carolinensis aca-miR-125b
    4. Anopheles gambiae aga-miR-125
    5. Ateles geoffroyi age-miR-125b
    6. Bactrocera dorsalis (oriental fruit fly) bdo-miR-125
    7. Blattella germanica (German cockroach) Bge-Mir-10-P3_5p (mature (guide))
    8. Bos taurus (cattle) bta-miR-125b
    9. Brachionus plicatilis Bpl-Mir-10-P3_5p (mature (guide))
    10. Branchiostoma belcheri bbe-miR-125a-5p
    11. Branchiostoma floridae bfl-miR-125a-5p
    12. Branchiostoma lanceolatum (amphioxus) Bla-Mir-10-P3_5p (mature (guide))
    13. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-125b
    14. Callorhinchus milii (elephant shark) Cmi-Mir-10-P3d_5p (mature (guide))
    15. Canis lupus familiaris cfa-miR-125b
    16. Capitella teleta cte-miR-125
    17. Capra hircus miR-125b
    18. Cavia porcellus (domestic guinea pig) cpo-miR-125b-5p
    19. Centruroides sculpturatus Csc-Mir-10-P3r2_5p (mature (guide))
    20. Cervus elaphus (red deer) cel-miR-125b
    21. Chrysemys picta bellii (western painted turtle) Cpi-Mir-10-P3d_5p (mature (guide))
    22. Chrysemys picta (Painted turtle) cpi-miR-125b-5p
    23. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-125
    24. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-125
    25. Columba livia cli-miR-125-5p
    26. Cricetulus griseus cgr-miR-125b-5p
    27. Culex quinquefasciatus cqu-miR-125-5p
    28. Cyprinus carpio (common carp) ccr-miR-125b
    29. Danio rerio (zebrafish) dre-miR-125b-5p
    30. Daphnia magna Dma-Mir-10-P3_5p (mature (guide))
    31. Daphnia pulex (common water flea) Dpu-Mir-10-P3_5p (mature (guide))
    32. Dasypus novemcinctus dno-miR-125b-5p
    33. Daubentonia madagascariensis dma-miR-125b
    34. Dinoponera quadriceps dqu-miR-125-5p
    35. Drosophila ananassae dan-miR-125
    36. Drosophila erecta der-miR-125
    37. Drosophila grimshawi dgr-miR-125
    38. Drosophila melanogaster (fruit fly) dme-miR-125-5p
    39. Drosophila mojavensis dmo-miR-125
    40. Drosophila persimilis dpe-miR-125
    41. Drosophila pseudoobscura dps-miR-125
    42. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294457_df_nrg
    43. Drosophila sechellia dse-miR-125
    44. Drosophila simulans dsi-miR-125
    45. Drosophila willistoni dwi-miR-125
    46. Drosophila yakuba dya-miR-125
    47. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-10-P3c_5p (mature (guide))
    48. Eptatretus burgeri Ebu-Mir-10-P3e_5p (mature (guide))
    49. Equus caballus (horse) eca-miR-125b-5p
    50. Gadus morhua (Atlantic cod) gmo-miR-125b-5p
    51. Gallus gallus gga-miR-125b-5p
    52. Gekko japonicus Gja-Mir-10-P3c_5p (mature (guide))
    53. Gorilla gorilla ggo-miR-125b
    54. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-125b
    55. Homo sapiens (human) hsa-miR-125b-5p
    56. Ictalurus punctatus (channel catfish) ipu-miR-125b
    57. Ixodes ricinus (castor bean tick) iri-miR-125b-5p
    58. Ixodes scapularis Isc-Mir-10-P3_5p (mature (guide))
    59. Lagothrix lagotricha (brown woolly monkey) lla-miR-125b
    60. Latimeria chalumnae Lch-Mir-10-P3d_5p (mature (guide))
    61. Lemur catta (Ring-tailed lemur) lca-miR-125b
    62. Lepisosteus oculatus Loc-Mir-10-P3c_5p (mature (guide))
    63. Lytechinus variegatus lva-miR-125-5p
    64. Macaca mulatta mml-miR-125b-5p
    65. Macaca nemestrina (pig-tailed macaque) mne-miR-125b
    66. Maylandia zebra (zebra mbuna) mze-miR-125b
    67. Microcaecilia unicolor Mun-Mir-10-P3d_5p (mature (guide))
    68. Microcebus murinus (gray mouse lemur) mmr-miR-125a
    69. Monopterus albus (swamp eel) Mal-Mir-10-P3c2_5p (mature (guide))
    70. Mus musculus (house mouse) mmu-miR-125b-5p
    71. Nasonia longicornis nlo-miR-125
    72. Nasonia vitripennis nvi-miR-125
    73. Neolamprologus brichardi nbr-miR-125b
    74. Nomascus leucogenys nle-miR-125b
    75. Oreochromis niloticus oni-miR-125b
    76. Ornithorhynchus anatinus oan-miR-125-5p
    77. Oryctolagus cuniculus (rabbit) ocu-miR-125b-5p
    78. Oryzias latipes (Japanese medaka) ola-miR-125b
    79. Otolemur garnettii oga-miR-125b
    80. Ovis aries microRNA miR-125b
    81. Pan paniscus (pygmy chimpanzee) ppa-miR-125b
    82. Pan troglodytes (chimpanzee) ptr-miR-125b
    83. Papio hamadryas (hamadryas baboon) pha-miR-125b
    84. Patiria miniata pmi-miR-125-5p
    85. Petromyzon marinus pma-miR-125-5p
    86. Pongo pygmaeus ppy-miR-125b
    87. Pteropus alecto pal-miR-125b-5p
    88. Ptychodera flava Pfl-Mir-10-P3j2_5p (mature (guide))
    89. Pundamilia nyererei pny-miR-125b
    90. Python bivittatus pbv-miR-125b-5p
    91. Rattus norvegicus (Norway rat) rno-miR-125b-5p
    92. Saccoglossus kowalevskii sko-miR-125a
    93. Saguinus labiatus (red-chested mustached tamarin) sla-miR-125b
    94. Salmo salar (Atlantic salmon) ssa-miR-125a-5p
    95. Sarcophilus harrisii (Tasmanian devil) sha-miR-125a
    96. Scyliorhinus torazame Sto-Mir-10-P3d_5p (mature (guide))
    97. Sphenodon punctatus Spt-Mir-10-P3c_5p (mature (guide))
    98. Strongylocentrotus purpuratus spu-miR-125-5p
    99. Sus scrofa (pig) ssc-miR-125b
    100. Taeniopygia guttata tgu-miR-125-5p
    101. Takifugu rubripes (torafugu) fru-miR-125b
    102. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-125b
    103. Tor tambroides (Thai mahseer) miR-125b-5p
    104. Tribolium castaneum (red flour beetle) tca-miR-125-5p
    105. Triops cancriformis tcf-miR-125
    106. Tupaia chinensis (Chinese tree shrew) tch-miR-125b-5p
    107. Xenopus laevis (African clawed frog) xla-miR-125b-5p
    108. Xenopus tropicalis xtr-miR-125b
    Publications New