Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-125b-5p URS0000209905_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, miRBase, PirBase, ENA, TarBase, MirGeneDB, LncBase). Described in 60 papers. Mus musculus (house mouse) mmu-miR-125b-5p sequence is a product of mmu-miR-125b-5p, Mir125b-1, 125b, miR-125b-5p, miR-125, 125, miR-125b, mmu-miR-125b, Mir125b-2 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including (alpha)1 subunit, 0610007A15Rik, 0610007I11Rik, 0610007K21Rik, 0610009C03Rik, 0610009I22Rik, 0610009M14Rik, 0610010E03Rik, 0610010F05Rik, 0610010I20Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCCUGAGACCCUAACUUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 96 other species

    1. Aedes aegypti aae-miR-125-5p
    2. Alligator mississippiensis (American alligator) ami-miR-125b-5p
    3. Anolis carolinensis (green anole) aca-miR-125b
    4. Anopheles gambiae (African malaria mosquito) aga-miR-125
    5. Ateles geoffroyi age-miR-125b
    6. Bactrocera dorsalis (oriental fruit fly) bdo-miR-125
    7. Blattella germanica (German cockroach) Bge-Mir-10-P3_5p (mature (guide))
    8. Bos taurus bta-miR-125b
    9. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-125a-5p
    10. Branchiostoma floridae (Florida lancelet) bfl-miR-125a-5p
    11. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-125b
    12. Callorhinchus milii eshark_mir-125_2
    13. Canis lupus familiaris cfa-miR-125b
    14. Capitella teleta cte-miR-125
    15. Capra hircus (goat) miR-125b
    16. Cavia porcellus (domestic guinea pig) cpo-miR-125b-5p
    17. Cervus elaphus cel-miR-125b
    18. Chrysemys picta bellii (western painted turtle) Cpi-Mir-10-P3a_5p (mature (guide))
    19. Chrysemys picta (Painted turtle) cpi-miR-125b-5p
    20. Cochliomyia hominivorax mature cho-miR-125
    21. Cochliomyia macellaria mature cma-miR-125
    22. Columba livia (rock pigeon) cli-miR-125-5p
    23. Cricetulus griseus (Chinese hamster) cgr-miR-125b-5p
    24. Culex quinquefasciatus (southern house mosquito) cqu-miR-125-5p
    25. Cyprinus carpio (common carp) ccr-miR-125b
    26. Danio rerio dre-miR-125b-5p
    27. Daphnia pulex Dpu-Mir-10-P3_5p (mature (guide))
    28. Dasypus novemcinctus dno-miR-125b-5p
    29. Daubentonia madagascariensis dma-miR-125b
    30. Dinoponera quadriceps dqu-miR-125-5p
    31. Drosophila ananassae dan-miR-125
    32. Drosophila erecta der-miR-125
    33. Drosophila grimshawi dgr-miR-125
    34. Drosophila melanogaster (fruit fly) dme-miR-125-5p
    35. Drosophila mojavensis dmo-miR-125
    36. Drosophila persimilis dpe-miR-125
    37. Drosophila pseudoobscura dps-miR-125
    38. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294457_df_nrg
    39. Drosophila sechellia dse-miR-125
    40. Drosophila simulans dsi-miR-125
    41. Drosophila willistoni dwi-miR-125
    42. Drosophila yakuba dya-miR-125
    43. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-10-P3c_5p (mature (guide))
    44. Equus caballus eca-miR-125b-5p
    45. Gadus morhua (Atlantic cod) gmo-miR-125b-5p
    46. Gallus gallus gga-miR-125b-5p
    47. Gorilla gorilla (western gorilla) ggo-miR-125b
    48. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-125b
    49. Homo sapiens hsa-miR-125b-5p
    50. Ictalurus punctatus ipu-miR-125b
    51. Ixodes ricinus (castor bean tick) iri-miR-125b-5p
    52. Ixodes scapularis (black-legged tick) Isc-Mir-10-P3_5p (mature (guide))
    53. Lagothrix lagotricha lla-miR-125b
    54. Lemur catta lca-miR-125b
    55. Lytechinus variegatus lva-miR-125-5p
    56. Macaca mulatta (Rhesus monkey) mml-miR-125b-5p
    57. Macaca nemestrina (pig-tailed macaque) mne-miR-125b
    58. Maylandia zebra (zebra mbuna) mze-miR-125b
    59. Microcebus murinus (gray mouse lemur) mmr-miR-125a
    60. Monodelphis domestica (gray short-tailed opossum) mdo-miR-125b-5p
    61. Nasonia longicornis nlo-miR-125
    62. Nasonia vitripennis nvi-miR-125
    63. Neolamprologus brichardi nbr-miR-125b
    64. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-125b
    65. Oreochromis niloticus oni-miR-125b
    66. Ornithorhynchus anatinus oan-miR-125-5p
    67. Oryctolagus cuniculus (rabbit) ocu-miR-125b-5p
    68. Oryzias latipes ola-miR-125b
    69. Otolemur garnettii oga-miR-125b
    70. Ovis aries (sheep) microRNA miR-125b
    71. Pan paniscus ppa-miR-125b
    72. Pan troglodytes ptr-miR-125b
    73. Papio hamadryas (hamadryas baboon) pha-miR-125b
    74. Patiria miniata pmi-miR-125-5p
    75. Petromyzon marinus (sea lamprey) pma-miR-125-5p
    76. Pongo pygmaeus ppy-miR-125b
    77. Pteropus alecto (black flying fox) pal-miR-125b-5p
    78. Ptychodera flava Pfl-Mir-10-P3_5p (mature (guide))
    79. Pundamilia nyererei pny-miR-125b
    80. Python bivittatus pbv-miR-125b-5p
    81. Rattus norvegicus rno-miR-125b-5p
    82. Saccoglossus kowalevskii sko-miR-125a
    83. Saguinus labiatus sla-miR-125b
    84. Salmo salar ssa-miR-125a-5p
    85. Sarcophilus harrisii sha-miR-125a
    86. Scyliorhinus torazame Sto-Mir-10-P3c_5p (mature (guide))
    87. Strongylocentrotus purpuratus spu-miR-125-5p
    88. Sus scrofa ssc-miR-125b
    89. Taeniopygia guttata (zebra finch) tgu-miR-125-5p
    90. Takifugu rubripes fru-miR-125b
    91. Tetraodon nigroviridis tni-miR-125b
    92. Tor tambroides (Thai mahseer) miR-125b-5p
    93. Tribolium castaneum (red flour beetle) tca-miR-125-5p
    94. Triops cancriformis tcf-miR-125
    95. Tupaia chinensis (Chinese tree shrew) tch-miR-125b-5p
    96. Xenopus laevis xla-miR-125b-5p
    97. Xenopus tropicalis (tropical clawed frog) xtr-miR-125b