Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-106a URS00002075FA_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-mir-17: Eca-mir-17, eca-miR-8908a, and eca-miR-369-5p were used as reference genes in the study [PMC6302407]. These microRNAs have orthologous pre-miRNAs, including eca-mir-17, eca-mir-18a, eca-mir-19a, eca-mir-19b, eca-mir-20a, and eca-mir-92a [PMC3005926]. In a study investigating endometritis in mares, eca-miR-155, eca-miR-223, eca-mir-17, eca-miR-200a, and eca-miR-205 were found to target inflammatory immune response genes [PMC8227551]. These microRNAs were significantly over-expressed in both young and old diseased mares compared to healthy mares [PMC8227551]. This study was the first to investigate the expression profile of these microRNAs in mares with endometritis [PMC8227551]. The relative abundance of these microRNAs was higher in diseased mares compared to healthy mares [PMC8227551]. The study also suggested that these microRNAs could be potential targets for further research [PMC8227551]. The main objective of the study was to investigate the expression profile of these microRNAs and measure the concentrations of IL-6, PGF2α, and PGE2 in serum samples from young and old mares with healthy and abnormal uterine status (endometritis) [PMC8227551].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGUGCUUACAGUGCAGGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis ami-miR-17-5p
  2. Anolis carolinensis aca-miR-17-5p
  3. Bos taurus (cattle) Bta-Mir-17-P1a_5p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-17
  5. Callorhinchus milii (elephant shark) Cmi-Mir-17-P1a_5p (mature (guide))
  6. Canis lupus familiaris (dog) Cfa-Mir-17-P1a_5p (mature (guide))
  7. Cavia porcellus cpo-miR-17-5p
  8. Cervus elaphus (red deer) cel-miR-17-5p
  9. Chiloscyllium plagiosum microRNA cpl-miR-17
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-17-P1a_5p (mature (guide))
  11. Columba livia Cli-Mir-17-P1a_5p (mature (guide))
  12. Cricetulus griseus (Chinese hamster) cgr-miR-17-5p
  13. Cyprinus carpio (common carp) ccr-miR-17-5p
  14. Danio rerio Dre-Mir-17-P1a2_5p (mature (guide))
  15. Dasypus novemcinctus dno-miR-17-5p
  16. Echinops telfairi Ete-Mir-17-P1a_5p (mature (guide))
  17. Gadus morhua Gmo-Mir-17-P1a2_5p (mature (guide))
  18. Gallus gallus Gga-Mir-17-P1a_5p (mature (guide))
  19. Gekko japonicus Gja-Mir-17-P1a_5p (mature (guide))
  20. Homo sapiens hsa-miR-17-5p
  21. Latimeria chalumnae Lch-Mir-17-P1a_5p (mature (guide))
  22. Lepisosteus oculatus (spotted gar) Loc-Mir-17-P1a_5p (mature (guide))
  23. Macaca mulatta (Rhesus monkey) Mml-Mir-17-P1a_5p (mature (guide))
  24. Microcaecilia unicolor Mun-Mir-17-P1a_5p (mature (guide))
  25. Microcebus murinus (gray mouse lemur) mmr-miR-17
  26. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-17-P1a_5p (mature (guide))
  27. Monopterus albus (swamp eel) Mal-Mir-17-P1a2_5p (mature (guide))
  28. Mus musculus (house mouse) mmu-miR-17-5p
  29. Nomascus leucogenys nle-miR-17
  30. Ornithorhynchus anatinus (platypus) oan-miR-17-5p
  31. Oryctolagus cuniculus ocu-miR-17-5p
  32. Otolemur garnettii oga-miR-17
  33. Pteropus alecto pal-miR-17-5p
  34. Python bivittatus Pbv-Mir-17-P1a_5p (mature (guide))
  35. Rattus norvegicus rno-miR-17-5p
  36. Salmo salar (Atlantic salmon) ssa-miR-17-5p
  37. Sarcophilus harrisii Sha-Mir-17-P1a_5p (mature (guide))
  38. Scyliorhinus torazame Sto-Mir-17-P1a_5p (mature (guide))
  39. Sphenodon punctatus (tuatara) Spt-Mir-17-P1a_5p (mature (guide))
  40. Sus scrofa (pig) ssc-miR-17-5p
  41. Taeniopygia guttata (zebra finch) tgu-miR-17a-5p
  42. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-17-P1a2_5p (mature (guide))
  43. Tupaia chinensis (Chinese tree shrew) tch-miR-17-5p
  44. Xenopus laevis (African clawed frog) Xla-Mir-17-P1a3_5p (mature (guide))
  45. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-17-P1a_5p (mature (guide))
Publications