Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-17-5p URS00002075FA_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (MalaCards, TarBase, ENA, miRBase, IntAct, MirGeneDB, GeneCards, PSICQUIC, LncBase, RefSeq). Homo sapiens (human) hsa-miR-17-5p sequence is a product of miR-17, hsa-miR-17-5p, MIR17, miR-17-5p, hsa-miR-17 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-Cys, 14-3-3, 14-3-3-zeta, 156DAG, 16A, 16E1BP, 1700010H15RiK, 182-FIP, 1A1-3B, 2'-PDE.

Interactions 79

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-17-5p interacts with:

Interaction id Participant Synonyms
EBI-21017296 intact:EBI-21017299 EBI-21017299 ENST00000291547 mrna_pknox1
EBI-21017504 intact:EBI-21017498 EBI-21017498 ENST00000295113 mrna_frzt
EBI-21019125 intact:EBI-21019117 EBI-21019117 ENST00000235329 mrna_mfn2
EBI-21019161 intact:EBI-21019154 EBI-21019154 ENST00000227507 mrna_ccnd1
EBI-21019606 intact:EBI-21019594 EBI-21019594 ENST00000405375 mrna_cdkn1a
EBI-21135996 intact:EBI-21019594 EBI-21019594 ENST00000405375 mrna_cdkn1a
EBI-21019834 intact:EBI-21019827 EBI-21019827 ENST00000297338 mrna_rad21
EBI-21283792 intact:EBI-21076444 EBI-21076444 ENST00000295754 mrna_tgfbr2
EBI-21076973 intact:EBI-21076444 EBI-21076444 ENST00000295754 mrna_tgfbr2
EBI-21197505 intact:EBI-21197452 EBI-21197452 ENST00000616296 mrna_mica
EBI-21197502 intact:EBI-21197489 EBI-21197489 ENST00000252229 mrna_micb
EBI-21273613 intact:EBI-21198129 EBI-21198129 ENST00000266085 mrna_timp3
EBI-21229305 intact:EBI-21229288 EBI-21229288 ENST00000430479 mrna_etv1
EBI-21273594 intact:EBI-21273597 EBI-21273597 ENST00000262768 mrna_timp2
EBI-21273607 intact:EBI-21277117 EBI-21277117 ENST00000313654 mrna_lama3
EBI-21273618 intact:EBI-21277239 EBI-21277239 ENST00000396578 mrna_col4a3
EBI-21280620 intact:EBI-21280590 EBI-21280590 ENST00000582401 mrna_vdup1
EBI-21335101 intact:EBI-21335131 EBI-21335131 ENST00000346562 mrna_npas3
EBI-21991005 intact:EBI-21990997 EBI-21990997 ENST00000263754 mrna_pcaf
EBI-21993373 intact:EBI-21990997 EBI-21990997 ENST00000263754 mrna_pcaf
EBI-21994827 intact:EBI-22016661 EBI-22016661 ENST00000282111 mrna_tcf7l1
EBI-22028512 intact:EBI-22028499 EBI-22028499 ENST00000342505 mrna_jak1
EBI-22030803 intact:EBI-22030861 EBI-22030861 ENST00000622179.4 mrna_sirpa
EBI-22034023 intact:EBI-22034013 EBI-22034013 ENST00000380659 mrna_tlr7
EBI-25826801 intact:EBI-25773021 EBI-25773021 ENST00000521381 mrna_pik3r1
URS00002075FA_9606-28 O95140 O95140
URS00002075FA_9606-0 O95140 O95140
URS00002075FA_9606-1 O95477 O95477
URS00002075FA_9606-29 O95477 O95477
URS00002075FA_9606-30 P01130 P01130
URS00002075FA_9606-2 P01130 P01130
URS00002075FA_9606-31 P01375 P01375
URS00002075FA_9606-3 P01375 P01375
URS00002075FA_9606-32 P05067 P05067
URS00002075FA_9606-4 P05067 P05067
URS00002075FA_9606-5 P10721 P10721
URS00002075FA_9606-33 P10721 P10721
URS00002075FA_9606-6 P15692 P15692
URS00002075FA_9606-34 P15692 P15692
URS00002075FA_9606-35 P23458 P23458
URS00002075FA_9606-7 P23458 P23458
URS00002075FA_9606-9 P37173 P37173
URS00002075FA_9606-37 P37173 P37173
URS00002075FA_9606-36 P37173 P37173
URS00002075FA_9606-8 P37173 P37173
URS00002075FA_9606-10 P38936 P38936
URS00002075FA_9606-38 P38936 P38936
URS00002075FA_9606-11 P40763 P40763
URS00002075FA_9606-12 P40763 P40763
URS00002075FA_9606-39 P40763 P40763
URS00002075FA_9606-40 P40763 P40763
URS00002075FA_9606-13 P50549 P50549
URS00002075FA_9606-41 P50549 P50549
URS00002075FA_9606-14 P54764 P54764
URS00002075FA_9606-42 P54764 P54764
URS00002075FA_9606-43 P78324 P78324
URS00002075FA_9606-26 P78324 P78324
URS00002075FA_9606-15 Q13485 Q13485
URS00002075FA_9606-44 Q13562 Q13562
URS00002075FA_9606-16 Q13562 Q13562
URS00002075FA_9606-45 Q13873 Q13873
URS00002075FA_9606-27 Q13873 Q13873
URS00002075FA_9606-17 Q15818 Q15818
URS00002075FA_9606-46 Q15818 Q15818
URS00002075FA_9606-18 Q5VWK5 Q5VWK5
URS00002075FA_9606-19 Q6IMN6 Q6IMN6
URS00002075FA_9606-47 Q6IMN6 Q6IMN6
URS00002075FA_9606-20 Q8NFP9 Q8NFP9
URS00002075FA_9606-48 Q8NFP9 Q8NFP9
URS00002075FA_9606-49 Q92886 Q92886
URS00002075FA_9606-21 Q92886 Q92886
URS00002075FA_9606-50 Q9BYX2 Q9BYX2
URS00002075FA_9606-22 Q9BYX2 Q9BYX2
URS00002075FA_9606-51 Q9HB63 Q9HB63
URS00002075FA_9606-23 Q9HB63 Q9HB63
URS00002075FA_9606-24 Q9NYK1 Q9NYK1
URS00002075FA_9606-52 Q9NYK1 Q9NYK1
URS00002075FA_9606-53 Q9NZV1 Q9NZV1
URS00002075FA_9606-25 Q9NZV1 Q9NZV1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAAAGUGCUUACAGUGCAGGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 45 other species

    1. Alligator mississippiensis ami-miR-17-5p
    2. Anolis carolinensis (green anole) aca-miR-17-5p
    3. Bos taurus Bta-Mir-17-P1a_5p (mature (guide))
    4. Callithrix jacchus cja-miR-17
    5. Callorhinchus milii Cmi-Mir-17-P1a_5p (mature (guide))
    6. Canis lupus familiaris Cfa-Mir-17-P1a_5p (mature (guide))
    7. Cavia porcellus cpo-miR-17-5p
    8. Cervus elaphus (red deer) cel-miR-17-5p
    9. Chiloscyllium plagiosum microRNA cpl-miR-17
    10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-17-P1a_5p (mature (guide))
    11. Columba livia (rock pigeon) Cli-Mir-17-P1a_5p (mature (guide))
    12. Cricetulus griseus cgr-miR-17-5p
    13. Cyprinus carpio (common carp) ccr-miR-17-5p
    14. Danio rerio Dre-Mir-17-P1a2_5p (mature (guide))
    15. Dasypus novemcinctus dno-miR-17-5p
    16. Echinops telfairi Ete-Mir-17-P1a_5p (mature (guide))
    17. Equus caballus (horse) eca-miR-17
    18. Gadus morhua Gmo-Mir-17-P1a2_5p (mature (guide))
    19. Gallus gallus (chicken) Gga-Mir-17-P1a_5p (mature (guide))
    20. Gekko japonicus Gja-Mir-17-P1a_5p (mature (guide))
    21. Latimeria chalumnae Lch-Mir-17-P1a_5p (mature (guide))
    22. Lepisosteus oculatus Loc-Mir-17-P1a_5p (mature (guide))
    23. Macaca mulatta (Rhesus monkey) Mml-Mir-17-P1a_5p (mature (guide))
    24. Microcaecilia unicolor Mun-Mir-17-P1a_5p (mature (guide))
    25. Microcebus murinus (gray mouse lemur) mmr-miR-17
    26. Monodelphis domestica Mdo-Mir-17-P1a_5p (mature (guide))
    27. Monopterus albus (swamp eel) Mal-Mir-17-P1a2_5p (mature (guide))
    28. Mus musculus mmu-miR-17-5p
    29. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-17
    30. Ornithorhynchus anatinus oan-miR-17-5p
    31. Oryctolagus cuniculus ocu-miR-17-5p
    32. Otolemur garnettii oga-miR-17
    33. Pteropus alecto (black flying fox) pal-miR-17-5p
    34. Python bivittatus (Burmese python) Pbv-Mir-17-P1a_5p (mature (guide))
    35. Rattus norvegicus rno-miR-17-5p
    36. Salmo salar ssa-miR-17-5p
    37. Sarcophilus harrisii Sha-Mir-17-P1a_5p (mature (guide))
    38. Scyliorhinus torazame Sto-Mir-17-P1a_5p (mature (guide))
    39. Sphenodon punctatus Spt-Mir-17-P1a_5p (mature (guide))
    40. Sus scrofa (pig) ssc-miR-17-5p
    41. Taeniopygia guttata tgu-miR-17a-5p
    42. Tetraodon nigroviridis Tni-Mir-17-P1a2_5p (mature (guide))
    43. Tupaia chinensis tch-miR-17-5p
    44. Xenopus laevis (African clawed frog) Xla-Mir-17-P1a3_5p (mature (guide))
    45. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-17-P1a_5p (mature (guide))
    Publications New