Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-17-5p URS00002075FA_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (TarBase, miRBase, LncBase, MirGeneDB, IntAct, ENA, RefSeq, MalaCards, GeneCards). Described in 109 papers. Homo sapiens (human) hsa-miR-17-5p sequence is a product of hsa-miR-17-5p, miR-17, MIR17, hsa-miR-17, miR-17-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-Cys, 14-3-3, 14-3-3-zeta, 156DAG, 16A, 16E1BP, 1700010H15RiK, 182-FIP, 1A1-3B, 2'-PDE.

Interactions 25

According to IntAct, Homo sapiens (human) hsa-miR-17-5p interacts with:

IntAct ID Participant Synonyms
EBI-21017296 intact:EBI-21017299 EBI-21017299 ENST00000291547 mrna_pknox1
EBI-21017504 intact:EBI-21017498 EBI-21017498 ENST00000295113 mrna_frzt
EBI-21019125 intact:EBI-21019117 EBI-21019117 ENST00000235329 mrna_mfn2
EBI-21019161 intact:EBI-21019154 EBI-21019154 ENST00000227507 mrna_ccnd1
EBI-21019606 intact:EBI-21019594 EBI-21019594 ENST00000405375 mrna_cdkn1a
EBI-21135996 intact:EBI-21019594 EBI-21019594 ENST00000405375 mrna_cdkn1a
EBI-21019834 intact:EBI-21019827 EBI-21019827 ENST00000297338 mrna_rad21
EBI-21283792 intact:EBI-21076444 EBI-21076444 ENST00000295754 mrna_tgfbr2
EBI-21076973 intact:EBI-21076444 EBI-21076444 ENST00000295754 mrna_tgfbr2
EBI-21197505 intact:EBI-21197452 EBI-21197452 ENST00000616296 mrna_mica
EBI-21197502 intact:EBI-21197489 EBI-21197489 ENST00000252229 mrna_micb
EBI-21273613 intact:EBI-21198129 EBI-21198129 ENST00000266085 mrna_timp3
EBI-21229305 intact:EBI-21229288 EBI-21229288 ENST00000430479 mrna_etv1
EBI-21273594 intact:EBI-21273597 EBI-21273597 ENST00000262768 mrna_timp2
EBI-21273607 intact:EBI-21277117 EBI-21277117 ENST00000313654 mrna_lama3
EBI-21273618 intact:EBI-21277239 EBI-21277239 ENST00000396578 mrna_col4a3
EBI-21280620 intact:EBI-21280590 EBI-21280590 ENST00000582401 mrna_vdup1
EBI-21335101 intact:EBI-21335131 EBI-21335131 ENST00000346562 mrna_npas3
EBI-21991005 intact:EBI-21990997 EBI-21990997 ENST00000263754 mrna_pcaf
EBI-21993373 intact:EBI-21990997 EBI-21990997 ENST00000263754 mrna_pcaf
EBI-21994827 intact:EBI-22016661 EBI-22016661 ENST00000282111 mrna_tcf7l1
EBI-22028512 intact:EBI-22028499 EBI-22028499 ENST00000342505 mrna_jak1
EBI-22030803 intact:EBI-22030861 EBI-22030861 ENST00000622179.4 mrna_sirpa
EBI-22034023 intact:EBI-22034013 EBI-22034013 ENST00000380659 mrna_tlr7
EBI-25826801 intact:EBI-25773021 EBI-25773021 ENST00000521381 mrna_pik3r1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAAAGUGCUUACAGUGCAGGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 35 other species

    1. Alligator mississippiensis (American alligator) ami-miR-17-5p
    2. Anolis carolinensis aca-miR-17-5p
    3. Bos taurus Bta-Mir-17-P1a_5p (mature (guide))
    4. Callithrix jacchus cja-miR-17
    5. Callorhinchus milii (elephant shark) eshark_mir-17_8
    6. Canis lupus familiaris (dog) Cfa-Mir-17-P1a_5p (mature (guide))
    7. Cavia porcellus cpo-miR-17-5p
    8. Cervus elaphus cel-miR-17-5p
    9. Chiloscyllium plagiosum microRNA cpl-miR-17
    10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-17-P1a_5p (mature (guide))
    11. Columba livia (rock pigeon) Cli-Mir-17-P1a_5p (mature (guide))
    12. Cricetulus griseus cgr-miR-17-5p
    13. Cyprinus carpio ccr-miR-17-5p
    14. Danio rerio (zebrafish) Dre-Mir-17-P1a2_5p (mature (guide))
    15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-17-5p
    16. Echinops telfairi Ete-Mir-17-P1a_5p (mature (guide))
    17. Equus caballus eca-miR-106a
    18. Gallus gallus (chicken) Gga-Mir-17-P1a_5p (mature (guide))
    19. Macaca mulatta (Rhesus monkey) Mml-Mir-17-P1a_5p (mature (guide))
    20. Microcebus murinus mmr-miR-17
    21. Monodelphis domestica Mdo-Mir-17-P1a_5p (mature (guide))
    22. Mus musculus (house mouse) mmu-miR-17-5p
    23. Nomascus leucogenys nle-miR-17
    24. Ornithorhynchus anatinus (platypus) oan-miR-17-5p
    25. Oryctolagus cuniculus (rabbit) ocu-miR-17-5p
    26. Otolemur garnettii oga-miR-17
    27. Pteropus alecto (black flying fox) pal-miR-17-5p
    28. Rattus norvegicus (Norway rat) rno-miR-17-5p
    29. Salmo salar ssa-miR-17-5p
    30. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-17-P1a_5p (mature (guide))
    31. Scyliorhinus torazame Sto-Mir-17-P1a_5p (mature (guide))
    32. Sus scrofa ssc-miR-17-5p
    33. Taeniopygia guttata tgu-miR-17a-5p
    34. Tupaia chinensis tch-miR-17-5p
    35. Xenopus laevis (African clawed frog) xla-miR-17-5p
    36. Xenopus tropicalis Xtr-Mir-17-P1a_5p (mature (guide))