Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) Gga-Mir-17-P1a_5p (mature (guide)) URS00002075FA_9031

Automated summary: This piRNA sequence is 23 nucleotides long and is found in Gallus gallus. Annotated by 2 databases (PirBase, MirGeneDB). Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAAAGUGCUUACAGUGCAGGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 45 other species

    1. Alligator mississippiensis (American alligator) ami-miR-17-5p
    2. Anolis carolinensis aca-miR-17-5p
    3. Bos taurus (cattle) Bta-Mir-17-P1a_5p (mature (guide))
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-17
    5. Callorhinchus milii (elephant shark) Cmi-Mir-17-P1a_5p (mature (guide))
    6. Canis lupus familiaris Cfa-Mir-17-P1a_5p (mature (guide))
    7. Cavia porcellus (domestic guinea pig) cpo-miR-17-5p
    8. Cervus elaphus (red deer) cel-miR-17-5p
    9. Chiloscyllium plagiosum microRNA cpl-miR-17
    10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-17-P1a_5p (mature (guide))
    11. Columba livia Cli-Mir-17-P1a_5p (mature (guide))
    12. Cricetulus griseus cgr-miR-17-5p
    13. Cyprinus carpio (common carp) ccr-miR-17-5p
    14. Danio rerio (zebrafish) Dre-Mir-17-P1a2_5p (mature (guide))
    15. Dasypus novemcinctus dno-miR-17-5p
    16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-17-P1a_5p (mature (guide))
    17. Equus caballus (horse) eca-miR-106a
    18. Gadus morhua (Atlantic cod) Gmo-Mir-17-P1a2_5p (mature (guide))
    19. Gekko japonicus Gja-Mir-17-P1a_5p (mature (guide))
    20. Homo sapiens (human) hsa-miR-17-5p
    21. Latimeria chalumnae Lch-Mir-17-P1a_5p (mature (guide))
    22. Lepisosteus oculatus Loc-Mir-17-P1a_5p (mature (guide))
    23. Macaca mulatta Mml-Mir-17-P1a_5p (mature (guide))
    24. Microcaecilia unicolor Mun-Mir-17-P1a_5p (mature (guide))
    25. Microcebus murinus (gray mouse lemur) mmr-miR-17
    26. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-17-P1a_5p (mature (guide))
    27. Monopterus albus (swamp eel) Mal-Mir-17-P1a2_5p (mature (guide))
    28. Mus musculus (house mouse) mmu-miR-17-5p
    29. Nomascus leucogenys nle-miR-17
    30. Ornithorhynchus anatinus oan-miR-17-5p
    31. Oryctolagus cuniculus (rabbit) ocu-miR-17-5p
    32. Otolemur garnettii oga-miR-17
    33. Pteropus alecto pal-miR-17-5p
    34. Python bivittatus Pbv-Mir-17-P1a_5p (mature (guide))
    35. Rattus norvegicus (Norway rat) rno-miR-17-5p
    36. Salmo salar (Atlantic salmon) ssa-miR-17-5p
    37. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-17-P1a_5p (mature (guide))
    38. Scyliorhinus torazame Sto-Mir-17-P1a_5p (mature (guide))
    39. Sphenodon punctatus Spt-Mir-17-P1a_5p (mature (guide))
    40. Sus scrofa (pig) ssc-miR-17-5p
    41. Taeniopygia guttata tgu-miR-17a-5p
    42. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-17-P1a2_5p (mature (guide))
    43. Tupaia chinensis (Chinese tree shrew) tch-miR-17-5p
    44. Xenopus laevis (African clawed frog) Xla-Mir-17-P1a3_5p (mature (guide))
    45. Xenopus tropicalis Xtr-Mir-17-P1a_5p (mature (guide))