Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Columba livia (rock pigeon) Cli-Mir-17-P1a_5p (mature (guide)) URS00002075FA_8932

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Columba livia. Annotated by 1 database (MirGeneDB).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAAAGUGCUUACAGUGCAGGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 45 other species

    1. Alligator mississippiensis ami-miR-17-5p
    2. Anolis carolinensis (green anole) aca-miR-17-5p
    3. Bos taurus Bta-Mir-17-P1a_5p (mature (guide))
    4. Callithrix jacchus cja-miR-17
    5. Callorhinchus milii Cmi-Mir-17-P1a_5p (mature (guide))
    6. Canis lupus familiaris Cfa-Mir-17-P1a_5p (mature (guide))
    7. Cavia porcellus cpo-miR-17-5p
    8. Cervus elaphus (red deer) cel-miR-17-5p
    9. Chiloscyllium plagiosum microRNA cpl-miR-17
    10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-17-P1a_5p (mature (guide))
    11. Cricetulus griseus cgr-miR-17-5p
    12. Cyprinus carpio (common carp) ccr-miR-17-5p
    13. Danio rerio Dre-Mir-17-P1a2_5p (mature (guide))
    14. Dasypus novemcinctus dno-miR-17-5p
    15. Echinops telfairi Ete-Mir-17-P1a_5p (mature (guide))
    16. Equus caballus (horse) eca-miR-17
    17. Gadus morhua Gmo-Mir-17-P1a2_5p (mature (guide))
    18. Gallus gallus (chicken) Gga-Mir-17-P1a_5p (mature (guide))
    19. Gekko japonicus Gja-Mir-17-P1a_5p (mature (guide))
    20. Homo sapiens hsa-miR-17-5p
    21. Latimeria chalumnae Lch-Mir-17-P1a_5p (mature (guide))
    22. Lepisosteus oculatus Loc-Mir-17-P1a_5p (mature (guide))
    23. Macaca mulatta (Rhesus monkey) Mml-Mir-17-P1a_5p (mature (guide))
    24. Microcaecilia unicolor Mun-Mir-17-P1a_5p (mature (guide))
    25. Microcebus murinus (gray mouse lemur) mmr-miR-17
    26. Monodelphis domestica Mdo-Mir-17-P1a_5p (mature (guide))
    27. Monopterus albus (swamp eel) Mal-Mir-17-P1a2_5p (mature (guide))
    28. Mus musculus mmu-miR-17-5p
    29. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-17
    30. Ornithorhynchus anatinus oan-miR-17-5p
    31. Oryctolagus cuniculus ocu-miR-17-5p
    32. Otolemur garnettii oga-miR-17
    33. Pteropus alecto (black flying fox) pal-miR-17-5p
    34. Python bivittatus (Burmese python) Pbv-Mir-17-P1a_5p (mature (guide))
    35. Rattus norvegicus rno-miR-17-5p
    36. Salmo salar ssa-miR-17-5p
    37. Sarcophilus harrisii Sha-Mir-17-P1a_5p (mature (guide))
    38. Scyliorhinus torazame Sto-Mir-17-P1a_5p (mature (guide))
    39. Sphenodon punctatus Spt-Mir-17-P1a_5p (mature (guide))
    40. Sus scrofa (pig) ssc-miR-17-5p
    41. Taeniopygia guttata tgu-miR-17a-5p
    42. Tetraodon nigroviridis Tni-Mir-17-P1a2_5p (mature (guide))
    43. Tupaia chinensis tch-miR-17-5p
    44. Xenopus laevis (African clawed frog) Xla-Mir-17-P1a3_5p (mature (guide))
    45. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-17-P1a_5p (mature (guide))