Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-17-5p URS00002075FA_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 9 databases (IntAct, ENA, RefSeq, PSICQUIC, LncBase, PirBase, MirGeneDB, TarBase, miRBase). Described in 61 papers. Mus musculus (house mouse) mmu-miR-17-5p sequence is a product of mmu-miR-17, miR-17-5p, Mir17, mmu-miR-17-5p, miR-17 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007C21Rik, 0610007L03Rik, 0610008C09Rik, 0610010B06Rik, 0610010I05Rik, 0610011D08Rik, 0610011K02Rik, 0610011L13Rik, 0610012D17Rik, 0610013E23Rik.

Interactions 10

According to PSICQUIC and IntAct, Mus musculus (house mouse) mmu-miR-17-5p interacts with:

Interaction id Participant Synonyms
EBI-21195870 intact:EBI-21195809 EBI-21195809 ENSMUST00000233296.1 mrna_cdkn1a-1
URS00002075FA_10090-5 B9EII4 B9EII4
URS00002075FA_10090-0 B9EII4 B9EII4
URS00002075FA_10090-1 P12032 P12032
URS00002075FA_10090-2 P61372 P61372
URS00002075FA_10090-6 P61372 P61372
URS00002075FA_10090-4 Q6PI17 Q6PI17
URS00002075FA_10090-7 Q6PI17 Q6PI17
URS00002075FA_10090-8 Q8CCH7 Q8CCH7
URS00002075FA_10090-3 Q8CCH7 Q8CCH7

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAAAGUGCUUACAGUGCAGGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 64 other species

    1. Alligator mississippiensis ami-miR-17-5p
    2. Anolis carolinensis aca-miR-17-5p
    3. Bos taurus (cattle) Bta-Mir-17-P1a_5p (mature (guide))
    4. Callithrix jacchus cja-miR-17
    5. Callorhinchus milii (elephant shark) eshark_mir-17_8
    6. Canis lupus familiaris Cfa-Mir-17-P1a_5p (mature (guide))
    7. Cavia porcellus (domestic guinea pig) cpo-miR-17-5p
    8. Cervus elaphus (red deer) cel-miR-17-5p
    9. Chiloscyllium plagiosum microRNA cpl-miR-17
    10. Chrysemys picta bellii Cpi-Mir-17-P1a_5p (mature (guide))
    11. Columba livia (rock pigeon) Cli-Mir-17-P1a_5p (mature (guide))
    12. Cricetulus griseus cgr-miR-17-5p
    13. Cyprinus carpio ccr-miR-17-5p
    14. Danio rerio (zebrafish) Dre-Mir-17-P1a2_5p (mature (guide))
    15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-17-5p
    16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-17-P1a_5p (mature (guide))
    17. Equus caballus (horse) eca-miR-17
    18. Gallus gallus (chicken) Gga-Mir-17-P1a_5p (mature (guide))
    19. Homo sapiens hsa-miR-17-5p
    20. Macaca mulatta Mml-Mir-17-P1a_5p (mature (guide))
    21. Microcebus murinus mmr-miR-17
    22. Monodelphis domestica Mdo-Mir-17-P1a_5p (mature (guide))
    23. Nomascus leucogenys nle-miR-17
    24. Ornithorhynchus anatinus oan-miR-17-5p
    25. Oryctolagus cuniculus (rabbit) ocu-miR-17-5p
    26. Otolemur garnettii oga-miR-17
    27. Pteropus alecto pal-miR-17-5p
    28. Rattus norvegicus rno-miR-17-5p
    29. Salmo salar (Atlantic salmon) ssa-miR-17-5p
    30. Sarcophilus harrisii Sha-Mir-17-P1a_5p (mature (guide))
    31. Scyliorhinus torazame (cloudy catshark) Sto-Mir-17-P1a_5p (mature (guide))
    32. Sus scrofa ssc-miR-17-5p
    33. Taeniopygia guttata (zebra finch) tgu-miR-17a-5p
    34. Tupaia chinensis tch-miR-17-5p
    35. Xenopus laevis (African clawed frog) xla-miR-17-5p
    36. Xenopus tropicalis Xtr-Mir-17-P1a_5p (mature (guide))