v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1655 (LINC01655) URS0000204966_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01655: LINC01655 is a long non-coding RNA (lncRNA) that has been investigated for its prognostic value in patients with breast cancer (BRCA) and other malignancies [PMC9136175]. In a study, a prognostic index was constructed using the expression levels of nine lncRNAs, including LINC01655, in BRCA samples [PMC9136175]. Another study found that the rs6687758 variant is associated with the expression of LINC01655 in lung tissue [PMC6038352]. In breast cancer cell lines, LINC01655 was found to be upregulated compared to normal breast epithelial cells [PMC8961446]. Additionally, LINC01655 was found to be upregulated in keloid lesion samples compared to normal skin samples [PMC9202908]. In terms of overall survival (OS), LINC01655 was one of the top 10 lncRNAs significantly associated with OS in a study [PMC6732947]. However, there was no correlation observed between immune cells and LINC01655 expression [PMC8351726]. Furthermore, LINC01655 was found to be highly expressed in tumor tissues compared to normal tissues [PMC8521053]. References: - PMC9136175 - PMC6038352 - PMC8961446 - PMC9202908 - PMC6732947 - PMC8351726 - PMC8521053

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGGCAAUGAGAACACCCUGGCAGGGCAGCUGAGCUGGGUGGAUCCUUGUUCUGUCACCAAGCCUUUAAGUCAUAUGCUGACAUGUUACAGUCCUGCCUGGGACCCUGCCCACAAAUACUUAAGAUACACGACUUUGGGAAUCACCCAACUGAUGGAAAGAACCAGGAAAGGGGUCAGGAUCUGCACCUUGGCAAACUUUGAAGAACACCCAAUUUGAUGAAUGAAAACUCCUCACUUGUGCUCUGGUGGUGUUUUAGGACAAUGGGCCCCUCCUGGAUGCUCCAGUGAAGCCCCAUAUCACCUUUUUCCUUCCUGUUUGCCAUAGCUCCAGGUGUAGGGACAGAUCAGAAGAUUCUGGAAAAGGCAGAUCACCAAAGAACUCAAGAUGUACUGAUAUUUUGCCAGUUUCCUUCAUCAACAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications