Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Dasypus novemcinctus tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4) secondary structure diagram

Dasypus novemcinctus tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4) URS00002034DC_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACGAGGUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 153 other species

  1. Acanthaster planci tRNA-Ser
  2. Ailuropoda melanoleuca tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 3)
  3. Albula glossodonta tRNA-OTHER
  4. Albula goreensis tRNA-Ser
  5. Alligator mississippiensis tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 3)
  6. Alligator sinensis (Chinese alligator) tRNA
  7. Alosa alosa tRNA-Ser
  8. Amazona aestiva tRNA
  9. Ameiurus melas tRNA-Ser
  10. Anas platyrhynchos tRNA
  11. Anguilla anguilla tRNA-Ser
  12. Anneissia japonica (Sea lily) tRNA-Ser
  13. Anolis carolinensis tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1, tRNA-Ser-GCT-2-2)
  14. Apaloderma vittatum tRNA
  15. Astyanax mexicanus (Mexican tetra) tRNA
  16. Ataeniobius toweri tRNA-Ser
  17. Balaenoptera acutorostrata scammoni tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 4)
  18. Bos taurus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 10)
  19. Branchiostoma floridae tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 8)
  20. Callipepla squamata tRNA
  21. Callithrix jacchus tRNA-Ser (GCT) (tRNA-Ser-GCT-3-1, tRNA-Ser-GCT-3-2)
  22. Callorhinchus milii tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1)
  23. Calypte anna tRNA
  24. Camelus ferus tRNA
  25. Canis lupus familiaris tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 3)
  26. Carlito syrichta tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 3)
  27. Cavia porcellus tRNA-Ser (GCT) (tRNA-Ser-GCT-3-1, tRNA-Ser-GCT-3-2)
  28. Ceratotherium simum simum tRNA-Ser (GCT) (tRNA-Ser-GCT-4 1 to 6)
  29. Cervus elaphus hippelaphus tRNA-Ser
  30. Chaetura pelagica tRNA
  31. Characodon lateralis tRNA-Ser
  32. Charadrius vociferus tRNA
  33. Chelonia mydas tRNA
  34. Chelydra serpentina tRNA-Ser
  35. Chlorocebus sabaeus tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 5)
  36. Choloepus hoffmanni tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 3)
  37. Chrysemys picta bellii tRNA-Ser (GCT) (tRNA-Ser-GCT-3-1, tRNA-Ser-GCT-3-2)
  38. Ciona intestinalis tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 8)
  39. Ciona savignyi tRNA
  40. Colinus virginianus (northern bobwhite) tRNA
  41. Colius striatus tRNA
  42. Columba livia tRNA
  43. Crenichthys baileyi tRNA-Ser
  44. Cricetulus griseus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 5)
  45. Cuculus canorus tRNA
  46. Dallia pectoralis tRNA-OTHER
  47. Danionella translucida tRNA-Ser
  48. Danio rerio tRNA-Ser (GCT) (tRNA-Ser-GCT-4 1 to 85)
  49. Dendronephthya gigantea (Carnation coral) tRNA-Ser
  50. Dipodomys ordii tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 5)
  51. Echinops telfairi tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 5)
  52. Eptesicus nilssonii tRNA-Ser
  53. Equus caballus tRNA-Ser (GCT) (tRNA-Ser-GCT-4 1 to 6)
  54. Erinaceus europaeus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 4)
  55. Felis catus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 4)
  56. Ficedula albicollis tRNA
  57. Fukomys damarensis tRNA
  58. Gadus morhua tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 7)
  59. Gallus gallus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 4)
  60. Gasterosteus aculeatus (three-spined stickleback) tRNA
  61. Geospiza fortis tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1)
  62. Gorilla gorilla gorilla tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 5)
  63. Heterocephalus glaber tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1, tRNA-Ser-GCT-2-2)
  64. Hippoglossus stenolepis (Pacific halibut) tRNA-Ser
  65. Homo sapiens (human) tRNA-Ser (anticodon GCT) 4-1 (TRS-GCT4 1 to 3)
  66. Ictidomys tridecemlineatus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 3)
  67. Lamprotornis superbus tRNA-OTHER
  68. Larimichthys crocea tRNA
  69. Latimeria chalumnae tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1, tRNA-Ser-GCT-1-2)
  70. Lepisosteus oculatus (spotted gar) tRNA
  71. Lonchura striata domestica (Bengalese finch) tRNA
  72. Loxodonta africana tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 3)
  73. Lytechinus variegatus (Green sea urchin) tRNA-Ser
  74. Macaca mulatta tRNA-Ser (GCT) (tRNA-Ser-GCT-3-2, tRNA-Ser-GCT-3-3, tRNA-Ser-GCT-3-5, tRNA-Ser-GCT-3-6)
  75. Manacus vitellinus (golden-collared manakin) tRNA
  76. Marmota monax (woodchuck) tRNA.Ser
  77. Megalops atlanticus (tarpon) tRNA-Ser
  78. Meleagris gallopavo tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 3)
  79. Melopsittacus undulatus tRNA-Ser (GCT) (tRNA-Ser-GCT-1-1)
  80. Merluccius polli tRNA-Ser
  81. Mesocricetus auratus (golden hamster) tRNA
  82. Microcebus murinus tRNA-Ser (GCT) (tRNA-Ser-GCT-3-1, tRNA-Ser-GCT-3-2)
  83. Monodelphis domestica tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 8)
  84. Mus caroli tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 3)
  85. Mus musculus castaneus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 3)
  86. Mus musculus domesticus tRNA-Ser (GCT) (tRNA-Ser-GCT-3-1, tRNA-Ser-GCT-3-2)
  87. Mus musculus musculus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 3)
  88. Mus musculus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 4, tRNA-Ser-GCT-4 1 to 3)
  89. Mus pahari tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 4)
  90. Mus spretus tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 3)
  91. Mustela putorius furo tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 3)
  92. Myotis brandtii tRNA
  93. Myotis davidii tRNA
  94. Myotis lucifugus tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 3)
  95. Nematostella vectensis tRNA-Ser for anticodon GCU
  96. Neotoma lepida tRNA
  97. Nipponia nippon tRNA
  98. Nomascus leucogenys tRNA-Ser (GCT) (tRNA-Ser-GCT-4 2 to 5)
  99. Notamacropus eugenii tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 7)
  100. Nothobranchius furzeri tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 4)
  101. Ochotona princeps tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 3)
  102. Ophiophagus hannah tRNA
  103. Oreochromis niloticus tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 6)
  104. Ornithorhynchus anatinus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 5)
  105. Oryctolagus cuniculus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 4)
  106. Oryzias latipes tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 4)
  107. Otolemur garnettii tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 3)
  108. Ovis aries tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 5)
  109. Pangasianodon gigas (Mekong giant catfish) tRNA-Ser
  110. Pangasianodon hypophthalmus tRNA-Ser
  111. Pangasius djambal tRNA-Ser
  112. Pan troglodytes tRNA-Ser (GCT) (tRNA-Ser-GCT-4 1 to 4)
  113. Papio anubis tRNA-Ser (GCT) (tRNA-Ser-GCT-4 1 to 5)
  114. Paramuricea clavata tRNA.Ser
  115. Patagioenas fasciata monilis tRNA
  116. Patiria miniata tRNA-Ser
  117. Pelecanus crispus tRNA
  118. Pelobates cultripes tRNA.Ser
  119. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  120. Perca flavescens (yellow perch) tRNA-Ser
  121. Perca fluviatilis tRNA-Ser
  122. Phalacrocorax carbo tRNA
  123. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  124. Dryobates pubescens tRNA
  125. Pleuronectes platessa tRNA-Ser
  126. Pocillopora damicornis tRNA-Ser
  127. Podarcis lilfordi tRNA.Ser
  128. Poecilia formosa tRNA
  129. Pongo abelii tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 5)
  130. Procavia capensis tRNA-Ser (GCT) (tRNA-Ser-GCT-5 1 to 3)
  131. Pteropus alecto (black flying fox) tRNA
  132. Rattus norvegicus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 4)
  133. Saccoglossus kowalevskii (Acorn worm) tRNA-Ser
  134. Saimiri boliviensis boliviensis tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 4)
  135. Salmo salar (Atlantic salmon) tRNA
  136. Sarcophilus harrisii tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 7)
  137. Scleropages formosus tRNA
  138. Sorex araneus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 5)
  139. Sphaerodactylus townsendi tRNA-Ser
  140. Strongylocentrotus purpuratus tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 16)
  141. Stylophora pistillata (Hood coral) tRNA-Ser
  142. Sus scrofa tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 6)
  143. Taeniopygia guttata tRNA-Ser (GCT) (tRNA-Ser-GCT-2-1)
  144. Takifugu rubripes tRNA-Ser (GCT) (tRNA-Ser-GCT-1 1 to 7)
  145. Tetraodon nigroviridis tRNA
  146. Tinamus guttatus tRNA
  147. Trichechus manatus latirostris tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 3)
  148. Tupaia chinensis (Chinese tree shrew) tRNA
  149. Tursiops truncatus tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 4)
  150. Vicugna pacos tRNA-Ser (GCT) (tRNA-Ser-GCT-3 1 to 6)
  151. Xenopus laevis (African clawed frog) tRNA
  152. Xenopus tropicalis tRNA-Ser (GCT) (tRNA-Ser-GCT-2 1 to 29)
  153. Xiphophorus maculatus tRNA
2D structure Publications